Description :
From Genome Similarity Track
Location :
Scaffold_2093:754- 2290
Transcript NameFunction/comments
Phypl_g14662hypothetical protein PHYSODRAFT_485789

Sequence
1536 bases(100 bases per row)
cggaGACTGCTGAATCGCAAcgtgggcggcgcgcgctcAGCGCTCATGGACAAGATGCTAAGCGTCAGTGATGCCACGGGGGCGGGGATATCGTCAGTGT
CGCCAACGACGCCGATACAGACGAGATATTGGTCTTCATGGACCAGGAggagcgacgcgagcgccCAGGCGTGGTCGCTGCGACAAGCTGGAGTCTGCTC
TTTTGCTAGAACGTCTCTGGGTGCGTTGCCGCGATGAGCTGTGGGTTGGGTGCTTTAGAGTGCGATATAAGCTAATAGTACGCTGGTGTTCGTGGTAAAT
ACAGACTGGAATCATAGTAAAAGTCTGCTAAATGAAGTCCATTGATACTCTACTCTGTGGCGAGAGCTGATTTGTCGCTGGTTTCCCCTGCTGTTGCGAT
ATCGCCCGCTGAGCTTACTCGTATTTGACGACTCCCTAATGTTGCTAGTGAGGTGGCCGCTATCGACTCCAAAATGGAGTCGATTTCAGACGCCATGTCA
GTTGGTACATCTTGAGCTGTGTGAGTGTCATTGGCAAGTCCGATACGCTCGAAATCTCCGACAATCGTTGCAGTCGTCATATTCTGCAATGTTTCAGCAA
CCCATGTCGTGATGTCCCTTCGGGTTGGCACCATGAGTTCAAAGCTGTTCCTATCTGCTTTCGTGTCCGTCGGTGTCGACATTGCGACTGTGTAGATTCG
TCGGGCATATCAGACGATGAACCCTTATCCTCTTGGTGCGTTATCGTACTCAATGAGCGGGCCTGTGATATACTGTGGATtgtttcttcttgttggtTGC
ATTCGCTGTCGTGTTGCATGCGTTGACACAGGAGCACAAGATCTGCAAAATAAGACAAAGTGATGCTGCTTGTGTTGCGCCGTCAGTTGTTACACCTCTC
GCCAGAACCAGCGGTCTCGAGTAAGAAATACATCCATCAGTGCTGGCACTCCCCACTGACATCAGGTAGGCTACCGCATCTTCACAACTATCACCCAGCA
AAGCTGTGCATCCTGTCGCTGCTTCACACATGTTAGATTCAGATGTGACACaggctgctgttgtcgcccTAGAAGCAACAGAGGCTGCCACCACTGTCAC
CGTCGCCGCTACCGTTGCTTCGGTCGCAGCAGATGCTGTTGTCGCTTTCCCTCGGGCTTGTGCGCTCGATCAATGCTCGGCAAGAAGAATTTACAAGACG
ATTGGAGGAACCAATCTGTTGGGGCAACGTCACCAACCCATATCGTGTGGGCGTTGCCGCAATTCGCTCTGCCGATCGTGTGTCATCGCGCCCATCGACA
CTAGAGGCATTGCTGCCACCTGCCCGACCTGCAGGTTCCCTGTTTTTCCGAGGTCCCATACAGCTCTACCACAAACGCCACCAACTCTATGCAGACCTGG
CTCGAGGACTCTGACGCTTCAGCCGGGAACGACAGCGATTAATCGGATGTTGTAAACATGTATTTGCTTTCGTCAAAAATAGCGAACACATTTTTGTTTT
TAGACAGCGCCAGTTTTGCTCAGAGCATTGGGCAAG