Description :
From Genome Similarity Track
Location :
contig_18:753987- 756742
Transcript NameFunction/comments
g4727.t1hypothetical protein

Sequence
2755 bases(100 bases per row)
TACTTCACATCCAGTCCACCCTCGTGCTATCTGCAGGGACCCACGGCACCTCCAGCCAACGCGTGACGATGACAGATCCACCTTCTGTGGTCCGCCAAGT
AGTGAAAGAGTTCCAGGCCCTTGGACCCTTCGAGTTGGTGCCTCCACGACCTAAGGAGACTTCGTACATATTCAAGTGGGGGGTTCGTGTCAAGTATATC
GAGAACGAGAAGGAGGTCTTCGCGTGGGCTTGTTTGGCCGACGAGGCGTTTCGGACGTCAGGAAAAAACCTGCTCAACTGACAAAACGACCATGGCCGTG
AAGCACCTCCAGAAGATACACAACGTTGGTTCGCCGAAAACGGAGACAGCGACCGTCAAGAAGCGCAGACACGATCATGGTTACAGCCACCTGTCATCGT
CGCTCTGTACTCAATCAACCCAACCCGGCTAAACGTGCCGATGACCACATCAACCATAACTTGACATTTCGCATCGTGGAGTACAAAGAGGCAACACTCA
TCCAAGCGCTACTCTATAAGGACGAGATGAAGGCCAAGATAACTACAAAGCAGGCGAAGGAATCTATCGTGGAGCTGTATTTTCAACACGCAAGGAGATC
ACTAACTACCTCCAAGAGAACCGAGAGGACTACCTGAACTTTACGCTCGTGGCAGATTTTTGGACTTGCAAAACAGCGCAAGACAAGTATCTTGGGTTGC
AGGTTTACCTGGCGGACAAGGCCTGGGAGTATATGTCCATTCTCTTGGGAACGAGAAAGTTCAACCCCGCAAATGGAGATCGTGATGGCGGCATTGTAAA
TCCCTTCAATGAGTGGCTGAAGCACATGCTTGAGGAGTTCGGCTTAGCGATGAGCGATTTTTATGGGGCTACAAGCGACTCGGGAGGTGACGTGAAATCG
ATGCTGTGCAAAGTACTCAATCGGCACTGGGAGTGACATGGCCCACGCAGCTACAAAGTTATCATGTGGTATAAATGGAGCTGCTAGTGCTGCAGCTAAT
CCGGAGATGGCGGACTTAATCTCACGGATGGTAAGAACAATCTTTCGGGTCAAGGTGGTGTCTGTCACTGGGAGCTTATTTGCAGAGCTCTGTAAGTCTA
ACACTCAGGGTGCCTCCACGCGACTTGTTGGATATTCTACGTCACGTTTCCTGAGCATGACGCATTCATTGGAGAGATTTCTTGAGAAGTGGCCTGCAAT
AACTGCGTGGTATGAAGAGCGAGCTCGTAAAGCACTTCGTGCCAACCAGCCACCACCAGAGTTCCCGTTGGCTAATCACCATGACGACTTGGTCCTTGTG
TTGTCTGTGCTGAAGCAAATCGGTGAGACCAAGTGAACATGTCAAGCAGAGCATCCTGTTCAAGTCGACGTGCTCGTACAGTTGTATGTAACGCGTATTC
ACCTGATCAATCTTTGCCACACTACCTACCAACCGACAAAAACCCTCGTTGGATTCCTGCAAGTGACCTTACACCACTGGCTGCGGATGCACGGAGACTA
TTGCGAGAATCATTGGACGAACGCTTCTTCAGCTGATATTACAACGACAAGCAATTCCACAGGTGTCAATTTGTATTTGAAATGCAGTTGAAACTCCACC
CTAGCTTCAAACGAACGGAGAGGAGTCTCGATCGTGCAGTGATTTTGTCGTGCCGTCAGCATGGCAAAAGCGGGAGGGATGCTATGACCAGGAAGAATGA
TGTGAACGCTAAAATCCGCTGCAACTTATTGAACTTATTTAAGTCAGTAAGTGAACCCGCGGACGTCTCTGAATTTGAACCACCTCCACCTGTTGTGCAA
GTCAGTCGACTGGAACCAGAATTTGCGCCGAGATCAGGCCGACCACCAACCTTTAGCCGGTAGGATCGACGCGCAGAAGAGGAACTTGATCGATGCCAGG
ATGATCCTGTTGACATTGCACGAAAGGAGGACTACACACCAAAGGAATCAGTACCGTATCACAAATGTCATATCCAGCAACGTGTTGTATCCGACACGTC
AAATTAGCCAATAGAATAGAGCAAATGTCATACTTGAAAACAAATGTCATATCCGACACCTAATTGGTGGACAGCAAACCGGGACACTTTAATTGGACGG
AAATGCAAGCACCTTCAGACTTTGGTATCTCGATCTCACTACGCAATGGGCAAGGAAGACACAAGCCTTGCTGCAGATTGACCACGTCGTCGAACGCTTC
GACAACCTGGGACTGCTAGATAAGGAGGTAGGTGAAGGGCGGAGGACCAGGACTACGTTGACCGTATAGTTAACAGCATTGAATACGCCGACGTTTAGTT
TGATATCAACCTTGTGGAGCATTTGATGTCTCCCTACCCACGCAGGCGCACACATGCGCATGACTCGAGCATTATCTTGTAGGACTTCGCTGGCCCCCCC
CCCTTCCTGAATTTAGTGATGCCATTAGACCTACTTCGCCTTGGCCTTTTGTCCGGAAGATATGTCCCATTTAATTCCTGACTATTCCTCAAATCCGTTG
CAAATGTTATTATCATATATGACAGGATCATCATTCAGGCAAATATCCGTGAATTTGGCTGCTGGATATGACACTTGCGATACGGTCCTTGAGTTTTGGC
AAAGACTCGAGCACCAAGGCGACTACCGTATCATACCGAAAGCTGTGAGAGTGCTGTTCTCAATACCAGTATCTTCGTGCCAGATTGAGCGTGATTTTGG
TGTAAGCGGGCAGATGGTAACTACACAGTGCACGACGTTAGCTGAGCACGACATC