Description :
From Genome Similarity Track
Location :
Scaffold_606:7538- 9789
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_606-snap-gene-0.10E3 ubiquitin-protein ligase TRIM33 isoform 2

Sequence
2251 bases(100 bases per row)
TCTTGGTAAATGTCTTCAAATCCAGCAGCAAGCTCGTCCGCGGCGCGTGTGATCCCAGACCCGTCGTCGTTGAACAGCTTGCAGTTCGACCACACAAGGC
GCACGTCGTTCGCAAACGCGTCAATGTCAATAATCTTCTCTCCCTGCTGCTGGCCACTGGCTGGCTTCGTGTACTTGTCGCTCTTCAGCTTTCCCTCGAT
CGTCGACAAGTCCATCGGCTGCTTTACAATTTTCCTGTAGTGCTCAATGTTTGTCACTGGGCTCAGGAACTGCTTCGAGTAAGGATGCGACTTGAGGCAT
CGGATCGCTTCGACACATTTACCGTAAATGCTCTGCTTCATGTCCACCGTCGCGCGGTATCGCACGAAGAACGACGGCTTTCTGCACTCGGCGCACTGCC
AGTCGCCTTCTGGCAAATCGCTCTCGCTCATTTTCAAGCACGCCAGGTGGAACGAGCGCGGGCAGACGTCGCAGCACACCAGGTCTCCAGCGGCAAAGCA
GACTTCGCAGTAGTCCAGGTTCGTGTCGATCTCGCTGTCGTCATCGTCGTCATCATCTTCCTGTACAGATTGCCTCTTTCCTGGTGTATTTTTGCCACCC
CCTCGCCCGTCTTTATGACCTCCTCTTGGAGTGCTTCCTCTCGCTGCAGGAGTAGCAGGTTTGCGTGGAGCCGGACTCTTTTTGTCCGATTGCTGAGCAT
TGCTAGAGGGGTCGCCGTTCCGCTTTCGACCAGTGGTTGGCGGCGCCTTCGGGGCTGCACGCTGGCGAGCATCCTTCTGCTTCCCTTTCGCGCTTGTTTT
CACAGTTGGGGACGGCTTCGGCGCAGTTTCTCTATCTGGTACAGCGCCACGAACGGAGTTCGACACCTGGGAAAGTCAATAGTACATAGTCGTCAGAGAA
TGTCAGAGAATCTTCATCGCAATCAATAAAAGGCATAATTGTTGTCCTCACCTCTCCTCGCTTGTGGGTCGTAAGTTTTCTTCCAGGTCCTGTTTTTGAA
TTCGAAGCAGACGTTTCGCTACTGGTTTCCGAATCAGCATGCACCGAGTCGTTCGCATCTCGCTTCCGCTTGGGGTTTCGACTCAAAGAGCCTGGTGCAG
CAGCATCGCCAGCATATGCAGAAGCTCTCGGTGCGCCTCGTTCGACATCTGAGCTGCGCGCATCAGGAGAATGCGATGGCATCAGATGGTCTTCAGCAGG
GGACGGCGTTCTGAGAGGAGCTGGTGCCAGCAGTTTGGCACTATTCGGTGGTGGCGGTGGAAGTGTTCCAGCTGGATCTTTTGGATCTGTAAACGCAGGG
ACAGTCGACGCCACCTCCTGGTTCAACGTCGTCAGCAATCTCACCAGTGACTTCTCAGACTCGGCGCAATTCAAGACATGGGCAGCTGAGGGGGACTCAA
GAGGCTCGCCAGGGTGGGCCCGACCAGGCGGTGGAGACTGCTCCATTGCACGAGGACCAAACGCAGAAGGGCCGCTTCCAGCGACATCCAGAGCCGTCGA
ATGAGCCGATGTGACGACGTCCTTAGCAGCACGCTTCGTTCCCCGATACGAATGCGAAGGAGGTTTCGCGCCCGCCTGCAGGTTTGGGAGCAATCGCGGG
TCGTCATCCTGCGAGAGGTCCACTTGCGGGGGAGCTGGTGGTGCTTGGAACGCTAACAGCTGTGCGTCCTCTACGTGTCGACGCTGGGATCCGTAGAGCT
CACGAATGCTTCGTCCAGCGTCCGGCAAGTACTCGTATCCTCCGCCGCTGCCACCACTGGCGTTGCTCCCAAAACTGCCGCGTTGCGGCTTCTTGCCCAG
TGGCGTCGGATTCGCAGGGATCCGCATACGCAGGTGGTCGCTTCCCATCGATCGATCCTCGCTATCGAGCTCATATTCGCGCTCGCCTGCAAGCCATCGC
TTGTACTTGCTGATCTCGTGCTGCTTCTCCAACTGACACGTCGAGCACGGGCACGATCGACTACAGACCGAGCATTTCAAGGATCGCTTGCTGACCGTCG
GGCGGTTCTTGCCCGCGAAGATGTCCTCCATGCGCACGCGATGCATACTGCGCAGGTGTTCTCGGCACAGCGAGTGGTTCACGTGGAACTCGGGGCAGAA
GTTGACCACGGGGATGAGGTGGCGCTCGTTCGTGCCGCACAAGTGGCAGATCCCCTTCGCAATGAAGCAGCAGTCCTGCTCGCCGACCATCTGCTTGAAC
GCCAGCGACATAGTCTCCGCGAGGATCAAGTCATCCAGATCCAGTTGCTCT