Description :
From Genome Similarity Track
Location :
Scaffold_67:75370- 76782
Transcript NameFunction/comments
g10512.t1hypothetical protein

Sequence
1412 bases(100 bases per row)
TTCTTTTTTGGTCCGCTTCGCGAGCGGAGACCGGGACCAAATCGCAAAGTCGGCGGCAAAGATGGGGCACTAGAGTCGGTCAGATCAGGTGCCCCGGCGC
TAACGTTCGATTGGAAAGAGATCGCTCGAAAATGGTCCTGTCCCCTAGCCGACGGTGGCGTGCCCAAAAGCGCCGCGTCTGCGGTCGCGTGCTGCCCGCG
GCCTTGCGCTCATTTCCGCTTTCCGACGCACGACCGCAGGCCTGTCGGCCGCAGCTCCGACACTGCCCACTTCCCATTTAGCCAGTCACGACTCGGACAG
CAGCTTTTCCTGCCGCAGGAAGGGCCTGTCACTAGTTGCGCGCGGGCCATTCTCGACCTCCCGCGCCGCACGGAGGAGCACGGACAGCGCTGGGGCGCGC
ACCTTGCTCGGCTCGGGCTGCTGCTGGTAAACTGCCTGCTGCGGCCGTTCCTGGCCTCGCCCCCGCCTTCCTCGCAGTCGATGCGCACACTACCGCCCGC
CGACACGGCAAAGGCGCCCGCCCACAAGGCGGAAATACCCGCGGACAAGTCGGTGCTGCCCGCCGACAGGTCGCTGGCCGCCGCCGTGCTGCAGCGCCTC
TCGATGGACGCTCCCGCCAGTACCGGCAGCAGTGGGAGCCCCACCAACAGCAGCAGCGAGCCGTCGCCCCAGGCGGCCGACGCCAAGGCGTTGCTCGAGA
CCAAGCCGCCGCAACAGGAACAGGAGCAGGACGCCGTGGACGTGCTGCAGGAGACGCTGCTGCGCCAGTCCACGGGGTCCATCGCCATCATGACGCGGCA
ACAGGAGGCCTTTGACCACCGCCGACACACGTTCAGCGCCATGGCGGCCGACAGCCGCGCCAACATGCGGCGGCGCAGCTACGACCTGTCGGCGACCTTC
GGCAGCACGTACCCGCCCAGCTCGCCGCACTCGCTCAAGACGCACCACCACCTGCAGCACTTGCGGGTCTACGGCAAGAGCGCGGGCTCCGCCAAGCGCA
TCGGCGAGTGCCACGAGGAGGGCGCGCCCTTGGTGGCGCTCGTGACCCCCAACCCGGACACGGTCTGGACGCGCGGCAAGCCCGTGGACATCGAGTGGAA
GGTGCTGGACGCCAAGGTGGAAAAGCTGCGCATCGAGCTGCTGGAGGACGGCCTGAGCGCCACGACGCTCATCGCCAGAGAAGCCCCCAACTCGGGCTTC
TTCACGTACCACCGCGTGCCGTGGGGCATGGAGTCGGGCTCCAAGTACTTCCTGCGCGTGTCGGCGGTCGACGCGCCCGAGCGGTTCCGCACCAGCAGCT
TCTTCCAGATCAGCTCGGCCCCGTGAGGCGGAAGGAATGGAGAGGAAGAGTTAGGACACAAGTATGTCAAGTCTATTTAATGTAACGCGAAGTAGTAAAC
GCCGCCAAAGAA