Description :
From Genome Similarity Track
Location :
Scaffold_31:75369- 77441
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_31-snap-gene-0.36Myosin

Sequence
2072 bases(100 bases per row)
GGCTGTGACGACATGATCGAGCTCAACCACCTGCACGAGGCTGCGATCCTCTACAACCTCAAGAAGCGGTTCCACAAGCGCCTGCCGTACACGTACACGG
GCGACATCTGTGTGGCGCTCAACCCGTACCAGTGGCTCGACGAGCTCTACTCCAAGGAGCTTCACACGCAGTACCTCAAAGCCAGGAGCAGGAAGCACCT
ACCGCCGCACGTGTACGCTGTCGCCGTGTCGTCCTACCAGCACATGAAAAAGTTCGAGGTAAACCAGAGCATTCTCGTAAGTGGCGAGTCCGGCGCCGGC
AAGACCGAGACGACCAAGATCGTCATGGACAACCTCGCGAGCATCGCGTCCGGCTCGCGACAAGAGACGATCACAAAGATTATTGAGGTGAACCCGCTGC
TCGAGTCTTTCGGGAATGCCAAGACAAAGCGCAACGACAACAGCAGTCGCTTCGGCAAGTTCACACAGCTCCAGTTTGATGACAAGCGCGTGCTCTGTGG
CGCCAAGTGCGAGACGTACTTGCTTGAGAAGACGCGCGTGATCACACAGGAACCGGGCGAGCGCAACTACCACATTTTCTACCAGNNNNNNNNNNTGTGC
ACGGCTCCTCGCAGCAGGAGAAGGAGATGTTTGGACTGGAAGGCGGGGGCTCGACGCTTAAGTTCGCGTACATGCAGGACGACGCGAGCATGATCGTGAA
GGACACAAAGAACTTCGCGAAGACGAAGACGGCACTTTCGATTCTAGGACTGGCGCAGAAGCAGCAACAGGCGCTCTTTCAGACGATCTCAGGCATTCTC
CACCTCGGCGAAGCAAAGTTCGAGAAGCGACCGGACAATGAGGACGCGAGTCAGCTTGATATGGACTCGGTCGCGTACAGCAACCTGCTGCTCGGCATTG
ACTCTGCGGCGATGGACAAGGCTCTCTGCAACCGCACGATGAAAGCCGGTGGGGAAGTGTACGCCGTGCCGCTGAGCTTGGATCAGGCCAAGTCCTGTCG
CGATGCGCTCGCGAAAGCGATCTACTCCAAGATCTTTGACTGGATGGTGCAGTGCATCAACGACAGTCTGAGCGCTGACCACATCATGGTGAATGCGATT
GGCGTGCTCGACATTTTCGGCTTTGAGAGCTTTGTTCACAACTCGTACGAACAGTTGTGTATCAACTACGCGAACGAGAAGCTGCAGCAGAAATTTACAC
AGGACGTGTTCAAGTCCGTGTACGAAGAGTACGAGCGCGAGCAGATCACATGGGACCATATTGAGTACGCGGATAACCATGAAGTGCTGGCGTTGATCGA
GAGCAAGATGGGCATCATCTCGCTGCTCAACGAAGAGATCGTGCGACCGAAGGGAAGCGAGGAAGGCTTTGTTGGCAAGCTTCAAACGCAGTACCGCACG
AGCAAGAAGATCATCGAGTTCGCACGAATCTCCAAGACCCAGTTCACGATCCACCACTACGCCGATAGTGTCAAATACGAGGCGACGGGGTTCCTGGAGA
AGCACAAGGATGCACTGCTCCCCGATCTCTCGGAGCTGATGCGAGCGAGTACTGAGCCTTTCTTGCAGAGCCTGTTTGAAAAAAAGGAAGATCCAGAAGA
CGCAGTAGCAGCAACGAGTGGAGAATCGGCTCGACCAGGGGCTCGGAAGCGCTCGGGTGGTGGGGACTCGGCGTCCATGACTGTGGGCACGCAGTTCAAG
CAGTCGCTGAACAAGCTCATGGAGAACATCAACCTCACGAACGTACACTACATCCGATGCATCAAGCCAAACAGTGTCAAGAGCGCAACTTTGATCGACG
AGGAGATGGTCGTGAACCAGCTGCGATGCGCCGGAGTCATCGAAGCGATCTCCATTGCACGAGCAGGGTACCCGAACCGTCTTCTGCACAGCGCCTTTGC
GACCGAATTCGACATTTTCCTGACCGAGGACCAGCAGAAGCACGGGGAGCCGGAAAAGAACTGCATGGTTCTTGTAAAACAGTTCAAGCTCAAGGCCCCA
GAAGAGTACCAGATGGGGAAAACCAAGATCTACTTGCAGAAAGGCATCCTCGAACGCCTGGACCACGCGAAG