Description :
From Genome Similarity Track
Location :
Scaffold_642:7535- 11396
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_642-fgenesh-gene-0.1HECT E3 ubiquitin ligase
Pytar_ATCC12531maker-par_contig_642-snap-gene-0.8Conserved gene of unknown function
Pytar_ATCC12531fgenesh_masked-par_contig_642-abinit-gene-0.18Eukaryotic translation initiation factor 4E type

Sequence
3861 bases(100 bases per row)
CAAACAGCGCTAGCCGCAGCGCCTGTCTCATGTGCGGCACGAGCGTCGGCTTTCTTATGTCGCGCAAGCTCTCGCGCCACCCCAGCGCGCACACATTTCT
CACCCTCGACGACGAGAGCTCTACGAATAAGAAAGCCGATGACGAAGAGATCCAGCGTACGAAGCAGCGTGCGCTGTTCAAGCGTCGCATGAACTCGATG
GCCACGCGCAAGAATCTCACGCAGCGCCAGCGCGGCGCGTTCCGCCGCCGCTTATGGGCGCGCAAGCTGGAAGCCGACGGCAAGTTCCACTGGGTGCGTA
TGGACTCGACGACGCCCGATGAAGTAGATGGCGATCTACCGCAGTTCTCGTCCATGACGAGCTCCAACGCGGCCATGAGCAACTTTCTCAAGTCGGGACC
AAACGGCGAACGCGTGAACGACACACACGTTAAGTCGCAGGGCTTTGTGTGGCAATACGATGACCTCGGGCGGCTTCAGTGGAAGGCGGCCGACGACGTC
TCGATCAATATCGACTCGTTCGAGGACATGAGCAAAGTGTTTCAAAAGGACGAGAACATAGACCTGGAAGGCATCATGGCGCTGGATTTCCGCCGCAAGA
AGCAATGGTTCCTGGTCCACTTGGCGCGCATCGCGACGCCCGTGACTGAGGCCGTCGCCAAGCTGAGTACGTCAATGATGTTCGATGGTGCCTCTATGAC
TGTGTAGTCCCCTGACGAAGTTGTTATATCCCGCAGCTATCCACCGTGACATGATCCTTGAAGAATCGGTCAACAAGCTGACGCTGCTGACCCCGAAGGA
GTTGCACACGTACCTAAAGATCACGTTTGACGGGGAGCCGGGCATTGACGCTGGTGGGCTCCTGCGCGAGTGGTTTGGGCTCGTGTGCAAGGAGATTTTT
AGCGAGAAGCTTGGGCTGTTTGTCCCCACGAAGGGCGAGAACATGAGCTACTGGATCAACCCGCTCTCGGGCGAAAAGACCGAGACCCACCTCCAGTATT
TCCGGTTCGCTGGAATCCTCATTGGCAAGGCGCTCTTTGAAGGGCTCGTCTTGGACGTCCAGCTCGCGCTGCCACTGCTCAAGCATATGCTGGGTGTGCC
CATCTCGTTTTCGGATCTCGAGTTTCTCGACGAGGATCTCCACCGCAACTGCAATTGGCTCAAGCAGAACAGTCAAGTGGACGCATTGTGCTTGACGTTC
AGTATCATGATGGAGAATGGCAAGGAATTGGATCTGAAAGAAGACGGCCGCAACATTGACGTGACCGACGAGAACAAGGAAGAGTATCTTCGGCTCGTGC
TGCAACACCGCATGCTCGCGAGTATCTCCGAGCAGCTCCAAGAGATGCTGACAGGAATCTACGACGTTGTGCCCAAGACCTTGCTATCGGTGTTTGACTA
TCAAGAGCTGGAGCTGATGCTCTGCGGCATCCCGACAATCGACCCAACCGACTGGAAGGCCAACACCAAGGTCCGGTATATCAGCGAAGAAGTCAACAAG
AAGTGGAAGATTTCCACAGAGGCCCAGGACGCCGTGATCGAGTGGTTCTGGATAGTCATTGAAGGGCTCACCCCCGAGGAGCGAGCGCGGCTGCTCCAGT
TTGCGACAGGCACCAGTCGCGTCCCCGTGGAAGGCTTCAAGGGGCTCACGAGCTCAAGCGGCATTATCCACCCGTTCACGATCCAGCTCATGCCACGAGA
GAATAATTCGTCTGCACTGTTCCCAAAGGCACATACGTGTTTCAACCGTATCGAGCTGCCCGTGTACCGCGATCTGGAAGAGCTCGAGACGTACCTGTCC
ATTGTATTTGAGATGGAGATTCTCGGCTTTGGACTCGAGTAGTTGGCGATTTTTGTGGGCTGTAACATTTCAAAATCATTTAAAACTATGGGGATTCGCT
ACTGTTTGATGCCTGCTCCTTGGCGGCTCGAATGTCCTGCGCAAGCATCTGCCGCTCTCGCTCGGCCACACGCTCGCGTATTCCGCTCGCGCCGACTCCG
CTTTTGTCAGTCACGGCGGCGGACCGTCGCTTGGAAGCAACGGGAGTCTTCTGATTATCATCAGCTGTTGAGGCCGGCGCCAGTCGTTCCTGCAGTTTCC
CCAGCTCGGCTTTGAGCAGGTCGAATCGATCCAGCCACGGGCGTAGTGTCTCCTCATACTCCTGCAGGAAAGACGGTAGCTCTGTGCGTGACGGCGGCTC
CACCGGCTTCTCCACGGCTGCAAGCACGTTTTTGTCGGTATCCGGAATTACTGCTTTGTCGGTCAGGGGCTTTTCCTGCGTTGCAATCGTTCCGCTGGCC
TTCTGAGCGATCGTGTCGCCGCGCGCTTCCCGTTCCAGTTGCTGGATCCGTTCGCGTAGCTCCTCGATCATCTGCGTGAGCACGAGGTCCTTTTGCTCAC
GCGCGACTTCACCTGCGAGCTCCTCCTGAACTTGTTCTAAGCGAAGCCTCTCGTTCTCTTCGTTCATTCGGCGCTTGACAGAGTTGAGGAAGAGTGCCAA
TAGTGTGCCAGGCGCAAACGCGATCATCCCGTAGACAAGCTTCCGTCGCGGCGTCAAAAGATTTCTGCAGCCACCAGCAGAAGAACAGTTAGTACAAGAG
ACGAGGCATCACGTTGAGGAGAGAATCAGAGCCGTACTGCATCGCGTCGGGCGGCGGCTCCGCGAACAATTGCTTCCACATGCCGCTCATCGTCGCTCTG
TTGATGACACTTTCCACCATTGACATGGCCACGCTAACATTAAGTTCGCACATACGAAGCCATGCGTACTTAACGGAGGTGACTCAAATGCGATCCCATG
GACGACGCTACCGTCGCTCGTGTGTTATATTTCCACAATGTAACTACATGCTGCATGCAGCGCCACGGCCCTTGGCTTTCTCAGCCGCGAGGGGGAGGAG
GGGCTTCCACGTTTAGTGGTTCTTGTGGACAAACTCACGGGCCGTCCACGCAGGTCCGGGGTTCTGCGGGTTCATGACGTCGATGATCTTGCCTCGGATC
TCGTCAGCGAGCACACGGTCGGTGGAGCGCAGCCAGATCTCGTAGCGGTAGTTGTTTCCCGATTCTTTCTTGTCTTTCTTGTTCTATTCAGCGATCAGCC
AAGCAATTCAGACATGATACGGAAGCGTCACCAGTCCTCGTATGCAGGTTCCCACTGGAGTGAACACCACAGGGCGATTGCATTCGTACCTTGTGGATCA
CGCGAACACCTGTGATCTCGTCGCCCGCGTCAAAGACCTCGCCGATCGCACCAAGCACGAGACGCTCCCAGCTCTCGTCCAGCACTTCCGCGCCCACCTC
TGTGATCCACCAAGACAGCAAACTGTTGGAATACAACATTCTATCGGCCACGGATCACCTCGAGTCATTCACGTACCTTTCCGCACGGACCACTCGCCAC
CGCGCTTGTTCTCGGGGTCTTCCCACTCGGGCACGATTCCTTCCTTGAACACAGCAAACGACTCGATCGCGCGGCCGTCCGAGAACTTCTTGCGTGTAAA
GCCGTCAAAAAGCACTTGGCTGCAATGTCGAAGCACCACACACGACAGTATGATCGTAGTCTCAGTTTACCTGTATCATTCACCTGCGGGGGGAGCGCTT
TAGTACTGTNNNNNNNNNNTCATAAACGACAACGAGACCGTATTCTCAGTCTTACGGTAGCATTCACCTGAGGGGGGAGCGCTTTAGTACTGTACCTGGG
CTTGGGGATGTTGTTCCAGTAGCTCCAGAACTCCTCGACCGTGCGGAACGTGCAGAGCTTGGAGAGTTTGTCAGCGTACGACATGCCCTTGGCCTGCTCT
CTCAGCTCCCAGAAGGACCACCCCGTCTGCAGCTCATGGCGCTTGGTCTCGTTCTCCGCCA