Description :
From Genome Similarity Track
Location :
contig_13:753463- 754825
Transcript NameFunction/comments
g2502.t1hypothetical protein F441_17638

Sequence
1362 bases(100 bases per row)
GGCCGCCGGGTCTTCGATCAGAGCAGTGAACTCGTTGATTTGCGGTAGTGAGTCTTGCTGCACCATCGCCATGTTAGATGGAGACAGTCGGCCTTGGTGG
AACGAGAACGCCTCGGTGTTTCTGGCTTCGACTGCAACTTTGCGTACGGCACCTGACGCCAAGACCCATCGTCAGAGCTCTCCGGGATGTGCGAGAGGCT
TGCTCCTCCCGTGATGAAGTAGTATTGGCTACGGATCAGCACCGTGAGCTCTTCCTCAATCTGCAGCAGCCGCGACTCTAAGTCGATGTCGTTCGCATCC
AAGCCAAACGGACATTCAATCTCCATCGCGACTTCATCGGCCATGAAGAGGAAGGTCCCCCACAAAAACACCCAAATCGGCGTGTAAAGACCCGAGTTCG
GCACAATGACGAAGGTGTAGAGCAGCATGTAGGCAGAAAGCAGGTACTGCAGGTACTGCATGTAGTTGAACGGGATCGGGACGTTGGCGATGTTGAACAC
CGTCGTGTACAGGTTCGGGAGTTGGGCGATCTTGATCTGCAAGTTATTCGCGTTGGGCAGCGTCAGATGGCCACGCCGAGTGGCAACCTGCACAAGTCGC
TTCAGCCAGAGCTCTGTGATCGTAGCACGCAGCTTGTGAGGGGTACGGCGCACCAGAGCACGGTATGACTCCTTGTCCTTGACCACCTTCTTGTGCTCCG
AGCCGCACGCATACAGCTCGTCGTACTCTGCCTCGGTCAGTACGCCCGAGTCCTTCAGCTTGTCGATACCGTCACGGCCACGGCAGTCGTGAAACACGAT
GGCAATGTACAGGAACACTAGACGACGTAGCTCTGTGAAGAACGTGCACTTCTCCAGCACATCGCGCGGAATCGACTGCTGCTTGTGTCGAGCACCTCCA
AGCTGCTTTCGCTTCTTGTCCAGTTCGATCTCTTCATCCAGAGTCCTTCCTGCTCGCTTTGCTGCCTCTGCAATAGCCTCGTCGTTCGTGTCCTCCACGC
CACGTTCCTTCAGCTCCTCCTTAATGGTGGTGCTCACGTATGCACAACCAGAGCCGACAATCTCCCGAGCCACTTCGGACAGCGACCCCACAGCCACCAT
CCCCGCTCTCCATTGTGTGAAAGCCGAATTCAATCGGAACGAGACGATGAGCCCCAGGAACGTGTTGAACACCGTCAACGAGTCTGTGAACGCCGTCGAG
TTGCGGGTGGCCACCACGAACGGGTGGTAGTGGTTGGCGACTGCAACGACCATGGCGACGGACGCCATGATCAGCGCTCGCACGGGGGCTTAGCCATTCA
AGGCGGAGCCGTGCCATCGCAGCAGCACCCCCCAGAGCCGCGACGTATTGTAGTAAATCATC