Description :
From Genome Similarity Track
Location :
Scaffold_3:75342- 76966
Transcript NameFunction/comments
Phymu_g203conserved hypothetical protein
Phymu_g204hypothetical protein PHYSODRAFT_284799
Phymu_g205hypothetical protein PHYSODRAFT_483482

Sequence
1624 bases(100 bases per row)
CTGTCGTCACATTCGAGTTGATGCTGGAACATAAGCGAGCGTCAATAGAGAATGCTGTAACGCCACACAACTCATGCTGCGTACCACGTACAATGCATCA
AATGCCTTGTTCTGCGGGGACTTCGGCGGGGAGCGTGTCGGCGACCTCGCCATGCTGACTCTTTGCCCAGGAAGCGACGCAGTCGTTtctttttgttgtt
gaagttcttTAAGTTGCAAATACTCCAGCAACATAAATTTGACAAGCAACGTAACTGCGCTGGTCAATGTCGCTGCTCCATTTGACCTTCTGGAAGCTAC
GACTGCAATGGTGGCTACCAAGAGCGACCCGAACTGCGTGGAGCCGGTGTGCGCCGACAAGATGGACTTCTTCAAAAGCGCTGTGGGAAAGAAGACAAAG
ACGACGGCGGTGAAGCCCACGGCGGTTGCTGACTGCCCACTGGATCGCCAGGAACTGGGCAACGCCACTTGGGGGCTGGTGAGTGTGGATTTATAGCGAT
ATCAAGAACTTGCAATGGTCTTACACTTGCTGGATGATTGTGcactgttgcagctgcattCGATGGGCATTTATTACCCGGACAAGCCGTCGCCCGAATA
CCAGGCGAAGGCCAAGACGTTCGTCGAGGCGTTGGCACTCATGTACCCGTGCGTTCACTGTGCTGATGATttccagaaggagatcgccaagtCTCCGCCA
CGGTGAGTCATAAGAGAAGTATAACCCTGTGGTATTGTGGTTGGTGTCTGACTTGAATGGTCGCGATTTTGCAGCGTGGAGTCGCGGACGACGTTCTCAA
TGTGGCTATGCGAGCAGCACAACATCGTGAACCGCAAGATCCACAAGCCTGTGTTTGAATGCACAATGGAGAACCTGGAGGAGCGATGGAGGAAAGGTAA
GCCGGCGTGTTGGGGCGAAGATGGTGACGAGGATACAGCCCAGGAGGCTTTAGGCTAAAGAGCCAAGGACGACATCACTAATGTCACGGCGAAAGTAGAa
gtacgtacatgtacttcgaagttAGAAGTACTAAGTAAACGATAGTTGTGTACATGGAGCATTGTCATCTGCCCCCGAGCTGTGAACAATGTTACAGCGC
AAAGTTAAACTTGGAACAGTTGTGACTCGGTCACTTGCTCTAGTTCGATTTCTCGATGCAAGTGGAGTCAGCTTTGTTATAACTCTTCGTGCTTGACTTC
GTTTGTATCTTTCTTGACTTGAGGACATACTATCGCACAAGCAAGCTGCAGTTAGTAGCTGCTCGCAATGGAAGTGCTGCGCAGAAATTTTACCTTGCAG
TATTCCACCGCACATCCGCTCCTTGGCCGGGGTAAAGTCATCGTAGAACGTGCGCGTCAGTTCGTCCTCGTATTCGCCAATAAAGTCGTTGCACTGTAGC
CATTATTGAGCAGGGTAGGCATTAGAAGCTGTACATCGCCAAATCTAGATAATGATATGTACCGCGGTGCTGAGCATTCGCTTGGTTTTGTGGTTGCTGC
CAGGAAGATCCAACGGGACCTGTTCGCagacgtcgtccagcacctccaagATGCGAGCCTATCAGGCGGGCAACAGATAGTAGTTACACCGTTAATGTCA
AACTAATGAAACACTGATACAGGC