Description :
From Genome Similarity Track
Location :
Scaffold_49:75311- 80594
Transcript NameFunction/comments
Hyaar_Emoy2806330hypothetical protein

Sequence
5283 bases(100 bases per row)
CCCGTACTGATAGTACGGCCTAAGGTGAACGACGTAGAACATAGGATGCGTGCGCATCTTACGTGGTAGTTCAATCATATATGCGTTACCTAGGCGGCGC
AGCACACGAAATAGACCGATGAACTTGGGTATTGACTTGTTACTTCCCACGTTAGTCACTATGTGTCGAGGTAGGTTTACCGTAGATAGTAGGACTAGGT
CGCCTTTATTGAATAAAAGAACATTTTCCCTTCCATTCTTGTCAGTGTTTAGTTTTTGTCGATCTACCGCCTCTGCGATATAGTCTTGTACGAAACGGAC
AACCGTTTCGCGAGCCAGTATAAATTTTTTTTTCTGTTGACTCGCTGCAGTGCTCTTGGAGCGTACTGAATCAAGATCACTTGTCGCCTCTGTGAGTGTG
CCTTTGGACGCACTAGGCGTGATGCTGATGTGATCAGTATCGTGGCCAGTAAGAGCATCTTCGCTTTTACTTTCGTCTTCTTCACCAAAGCCAATGTGAT
TGACATCGACGTCGAACGAGGTGACCGCATTGTCAGCACGTGATGAGTGAGAGACGGATTGACGGTCGCTCGAATGAGTCCCTCCCCTCTCAAACGAGAG
TCACACTCTAAAAAGGTGGGAAGACGCGGATGGCGTAAGCCATTCAAGAAGAACGGTGGTACGTCGTCGACGCATGGACTGAATTGTTGATGGCGAACTC
CACCATCGACAGGAATTCGCTCCAATTCGTAAAGGAATGGAAGTATCCTCGAATGATCTCCTCGAGGACACGATTGGCGCGTTCAGTCTGACCATCTGTT
TCAAGATGGTCAGACGTGGACATCTTTAAGCGCGTTCCGAGTGTTTTGAAGATGGACCGCAAGAATTCAGCTGTAAACGCGGGTCCCGATAGGACACGAG
TTCACGAGGCAACCCATGAAGGCGAAAGCCCGCGTCGATAAAGACACGGGAACAAGCCGATGCGTTGATTGACTCGGGTACATCAACCAGATGTACCATC
TTGCTGAACCTGTCAACGAACACAAGAATACCAGTTTTCTTGTGAGAGTCTGCGGGGAATCCAAAGACAAAGTCCATTGAGACGGATTCCCAGCACTCGG
CCGGGACGGGCAGAGGCCACAACGGGGATTAAAGGGAAGGACCAAATTTCACCCGTTGACAGACCTCTCAGGCCCGAACGTACTTGCGCACGAACTGATA
CTGACGGGGCCAGTAAAAGTCGCGGCTCACTGTGAGATTTGTTTTCTCACGACCACGATGTCCACCAACAGGTGCGTCGTGGTACCCATACATGATACGC
AATAGCAGATCACCATGATCTGGTACGACGACACGAAGTGTGTCGCCGGCAACAGCTGAATATTGGAGTAAGCCGTTGCGAACTGTATATCAATCCGTGT
CGGATCGATATACTGACGTCAACTGTTTGAGACTCTTCCCGGATGGATGTGAGAGATGATGCATCAATCGCACCATTCCCGGATCATACGCCTTTCATAT
GTCTTCCAATAAGGTTGACGACGGGACACTCAAAGTCAGTACCGCGACAGTGGTCGGACCAGTGTCGGGTGGTGCAGCAGGCTTGAAATCGGGCCGGCGC
GAGAGTACATCAGCGACGACGTTAAGTCGTCCTGGCTTATACTCGACGAATAAGTTATACTCCGCAAAGAATGACAGCCACTTAGCCATCCACTGCAAGA
GTTGTGGACTGTTTACGGCCATGTATAAAGACGGATGTTCCGTAGAAACGATGAAGGGTCTATCACGTAGCAGATAGACTCTAGACTTAGCCAGCGCGTA
CTTCGTGGCAAGGAGTTCCTTGTCATGGACGTGGTAGTTTCGTTCAGCTGGTTGCAGCTGGTGTGGCTGGTAACAGACGACACGCTCCGAATCGTCTACA
TCGTACTGCATTAATGCACAGACGGTTGCAAAGTCACAGACCACGTCGAATGGCCTGTCTTGGTCTGCACTTGCCAAAACTAGCGATCGTATCAAGCTTT
GCTTGATACCTTCGAAATAGCGCTGGCAGTCGGCACTCCATTCCCAATTCTCGTTCTTTTTCATAAACGAGAGAGATGAACAGTCATCTCGGCGTAATTG
CGTGAATAGTTATGCAAATACGCCGCCAGGCCAAGGAACTTTCGAAGTCTCTTCTGTAGGCACCGGCCAGTCGGTGGTCGCCTTGATCTTTTCTGGATCG
GGCCGGACGCCATGCTTGCCCACGATGCAACGAAGAAGTGGTATTTCGCTAGCAGCAAATATATGCTTCTTGAGGTTGGCGCACAACTTATGCTCTCGCA
TTAGTGTAAGAACTTTCCGGACGTGGAGTCGGTGCAATTCCACATCCGTCTGTCTATCCATAGCCCAGCTATGGACGAATACATCATTGAAGTAACTCTC
TTGCGGATCTTAATAGATTCGTTACACATCTGTTGAATATGGCAGGGGCATTACTAACCACTCCCAAAGCATACCGCTTGGGGTGTTCACTGCAGTATAG
GGAATGTACCTTTTGCGCATAAGGATCTGATAGAACCCGTACATCAGGTCCATGGATGAAAAGATGGTGCTCTTAGCCATATCGTCTATGATGACATCTT
TCCTTGGTATTGATGTTTGAGCCGGTACAGTGGCAGCGTTCAACTTGTTGAAGGCGTGTACTATCCGCCACCTTCCTGTGGCTTTCGCACACAGAAGGTC
GGAGAGCTATGTGGAGAGGTGGATACCCTCACATGGCCGGCTGCTAAGCGATCTGCAAAGAATTTGTCGATCGATAGTACTTGTTCACGAAACAGTGGCC
ATTGCTTCATGAAACAGTACTTCGAACCCGGTTTTATGTCAATTTCGTGACGAGTACCTTTGTCCTTAGGTAACTCGCACGGGACTGCCTCTGGGAATAC
ATCCCTGAATTCCATCAAATCATCGTAGAGAGGATTTGTTCTGAGCGATTTCCACGATTGGAATGTGTATCGCTCAATCCGAGTCTTCTCATCAAGGACA
CTCTTGACCATTGATGAGCTGCTAAGAACCATTTCGTTCTCAGCGAATACCAGTGCCGACCGAATATCGATTACGTACTCATCTTCCGTGACGAGTACGC
AAATCTGCTTGACTTTGCCACAACGCAGATCACGCAAGAACTTTTTCTGTTCGAGCGTGGGCAATTGAATGATCTCCGAAGTTGTCTTCGGAGGCGCGAT
CAGATCTAGTTGGTATGTTCCTATGCTTGATCCGTCATTGACTAGGACATTTAATGTCTCTGTCATCACATGGGACTTACTTCCACTATTTGTTAGGGAC
TCAATCCCTCAACTCTAGCCTCTTGGACTATTTCAATTCCGTCTTGGCCATCATTGGCAATTGGTTGGTCATGATCTGGGTGTTGTCCACTAAGAGGACA
ACCATGCCCCGGTCTGCTCGACTTATTCGAGAGGTGGGCCTTCGGTGCTTCCTGCATTTTTATGCAGTCGTCGGATTCTTGCTCCGCAATATGATGGTTA
GTCATATTGTGATCTTGCAGTCGTACTAACGACCGAACCACACGTGAAGCCATAGCACTCACTCGTAGTACAGCCACATGGTGGTGGACGCTCCAAGACG
TTCATCAGATGGGCGTCTGGTGAACAAGCGGCGGGCATATCGACACTTCGTCAATGCCAGCTGACTTGTGGCTCGTACCTTCTGAGACACGGCAGTCCAA
GGATAACATCAAATTTGTCATCCAAGTCTAATATGATGAAGTTATCATTATATTGGACTCCCTTCAGTGTATAGGAAATTCCTACTACACGTTTCATCAC
TGCTACGGATGCGCCTGTAGCGAGGCGTACCGTCATCCTCGTTCGAGGGATCTCTCGCTGATGTATTTGAGCTTGCTATTGTCTAGCGATTGGCGCCGTA
CAGAGTTGTTTGACGCCCCACAATCGACCAGGGCTCGTAGTGACATGTCATTTGCCACTTCGATTTTCAAGGTAATGAGGGAAACCTCATTACCAGATGC
AGTAACACACAATGATTGCGTGTTGGGAGCAATTCTCGTCAAGAGGCCTTCAAATTCACTTGGCGTTGCTGGATCAGTAGGGTGCTCCGCACATACTGAT
CCTGACCGTTTTTTGGTCGTCCGTTGCGGTGTTGCGTTTTCGCAATAGCGTCGGACCCACGCCACGGACCCTTCTTCGCCGCTTGACGGTTACTGTTTCC
TGCGGTACGTGGTACCGCGTTCGGGGCACTGCATTCGTATGCATAATGCCCTGTATTTTGACGCCTATTGCCTGTATGCAATTTCTTATAATTGGTAACG
TGAAATATTTCACTCTCAGCGCAACAGATGTCAATTGGTTCTGGGCCTCCGCTTTCCTGTCACTTCGGGGGACGATAGGAGTTTGAACTCACGTGAGCTT
GTTTCACGCTGAAATCTTCTTGTTCCGCAACTCGGATTGCCTCTTCCAAGTATCAAATTCCAACCGGAAGAGATAGGTCCTGACTGGACCGTCTGTGAGA
CCCTGCATGAACAACGTGATCAACGTTTGTCCATTCAGCGGGCTGGACGTGATGCCACTCGCGAGATGACGTATGTACTGAATGTACGAGTGTACATCAC
GTTATCCTTGTTTGAGTTTCAGGAGCTCAGAGCGAGCCCTGAACTCAGCTCGCGGTGGTTCGAATGTTTGCATAAGCAGAGAATTGAAGACTTCTAACGA
CCCAAAGACAAATGTGTCGTGTAGCTTGAGGCCCAAAGCCCAAGTCTTCGCACGCCCTTCCAAGCTCGACTGAGCAAATGCGACCTGCATTTGCTCATCG
ACGATGTGACGAGCCATTATGGCGTCATCTAGCTCAACAAACCATCTTAGCAGAGAGTCTTCCTCAGCTGCTTTGTATTGGAGATGTCAATCTTCAGTGA
TTCGGGTCGACGTGAGTGTTTCGACCCGGTGGCAGTAGCCTGCTGCTGTCTCAACAACTCGAACTGTTGAGCACTCTGTTCTCTCAACAGCTCTGTCTGC
TGATACCCTTGTTGGTGAAGCAAGGCTACCTTTCCCCGTTCAGCGTCAAGTTCATTCTGAATGACCTTGGCGATGGTGGCGTGTTGCCCGTCTGGACCCA
GCGCGGACAGCATTGCGCCTACGGCTTCTTGCCCAATCGTCGAACTCAAGCGTTCGACAGTATCTCATTCGATTTGACTCAAATGGGAGTAGCTCTCGTG
CGCTGGATGGAGATCTTCCGCTTCATCATCCAACATGTTCATAGTCGTTGGCCGGACGACGGAGCGCTACCAGGTGTAACGGG