Description :
From Genome Similarity Track
Location :
Scaffold_1527:753- 3742
Sequence
2989 bases(100 bases per row)
CACGGTCATCGGCCGGAAGTCCGAAGACAAAGTCGAGACTCATCGACTTCCAGCAGTCCGTTGGGACCGGCAGGCTCTGCAATGGTGCCGAGGCGTGACC
GGCAGGCTTCACGCGCTGGCACGTCTCGCACGTACGGACGTAGGTGGCGACCCACTTGTACATATGACGCCACCAAAACATCTGCGAGACAGACGCGTAC
GTCTTCTCACGGCCAAGATGGCCACTGGATGGAGCGCCGTGCGCCTCCATCAGGATGTCGTACTTGAGATCCTCGTCGTTGGGCACGACAATACGGGGAG
GATCCTCGGGCTCGACCCTATAGTGGAGCAAACCGTCAGCCCACTCATAGCGGTGCAGCCTTGCACGTTGTCGGGGCGTGAGCCACTCGGCCTTGGCTTC
CGAGCCAGCGGCCAAGAACCGCACAAGAGGTCCGAGACTGGCATCGTCTCGGTACCCCAGCCTGATGCGATCATACAGATCCGTCGTGACCCGACTAATA
TGAGCAAGCTCGTAGTCGGGTCGGCGCGACAGCGCGTCGGCAAGCACGTTCAACTTGCCCGGCTTGTACTCGACACGGAAGTTGTATTCCGCGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNATGACTCACCAAAGCTCTGTCAGAGCGTGGGAGACGGCTGGCCCCGATGGCCTTGCCGCGCCAGTCGATCCAAGGCTC
GTGTTTCTCCAGCCACGGCATACCAAGGATCAAGTCGTACTTGTCCATGTCTAGGACCAAGAACGGCTCCGTGCTGTCGAAGTCCTCGAACTTGACAGTG
AGGTCCATGTGGACCCGAGGTACTTCTACCACCGTACCGTCGGCCAGTCTTACCGAGACCAGCCCGTTGCCTTTGCTGCCTCGTAGCGCATCGGCGTACT
TGTCGCGATTGCGTGCGACAGTCTGGCGGCGCGCAAAGTTCTTGGACGCCCCAGAGTCGATCAAGATTCTCAAGGGATGATCGTATCCCGGTACACTCGC
GTGCACCACAAGCAGCCCACCGCTGCCCTTCTCCGCTTCGAGAGTACAGAGACTCTCAGGGGCTACGTCCCCATGGCGTGCGCCACCCGCACGCCCCTCA
TGAAGACCTAGTGTTTCCCCAGTAGGGCGCCCCGCCCCTACTGATGTCCGGCGTTCCCCCTGGTTCCTGGGGCGCGGCTTCTGCCAGCGACCCCTAGAGC
CAAAGGACTTCGAAGAGAACCTCTTCTTCAGTCCTCCCGCGGGACAAGCACGTTTCATGTGCCCAAGCTTGCCACAGCCGTAGCAGCGAATGCCGCTCTG
CTCGTCCATGCCCAGATCCATGGGAACCGGCCCGTTGATCGCTCCATTGCCGGAGTTACCATTAGGCGCATCGCCAGAGGCAGGGTTGC