Description :
From Genome Similarity Track
Location :
Scaffold_3442:753- 2543
Sequence
1790 bases(100 bases per row)
CGGAAGATGAGCAAGTCTGCTACCGTGAAGGCGGGGATCTACACGCCGAGGATCTGGGAGAAGGCATGGCGGTGATGCCGGAGGTACCACTGACCACAGA
AGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAATGAACCTGCTGAAGTGGATCGTCTGCGTCAGAAAATCTGGGAGGGCCGACATCTGCTG
ATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGTGGAGTCAAAGGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCGGAAGGTGG
CGCCTCACTTCCGAGAAAACTATCGGATCTGATTAAGGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCAGTGGTAAT
CATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCACAGATTACCGGCTGGTTAACGGCCTGACTCGATTGATGGTGTATCCGATGCCTCTAATCAAT
GAGCTGTTGGAAGATCTGGATAAAGTACTCTGGTACTGCTCTCTTGACATGGCCAGCGGTTTTTGGGTAGTTACTATGACGGATCGAGCTCGCGCGATAT
CCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCATTTGGATTGAAGAACGCACCCCAGATCTACCAACGTCTAATCGATAACGCTCT
CTATGGATTCACCCTAAGACCGGAACCCCAAAGGGGTGGATCCGGGGAAGATCATACGGAAGTAGATCCATTTGAGTCAGGAGAGCCAGGGGATCCTGGA
ACCCCGTCCGTGTTAGGACGCAGATCTTACATCGACGACATTCTAATCCCGGCGAAATCGTGGGATCAGCTGTGCAAAAGAGTGACATCCCTACTGGAGG
CGTGTACTAAGTGGAATCTCTCTATCAGTGTGGTAAAGAGCTATTGGGGGACGCGCAAGGTGGATTACTTAGGCCATCGAGTTCCCAAGGAGGGATTGGA
GGCGAGTCCTAAGGACCTGTCTTCGTTAGCCGATTTGTCCTTCCCGCAGTCGTTACGGGCGATGCAATCCTTCTTGGGCAGTTTGAACTACTACAGTCGG
TTCATCGAGGATTACGCCCTGTTTGCCGCGGTATTGTATGAATTGAGAGAGGTAGATTTTGCTGCGATGACCACTCCAGCTGTCCGGATAAAAATCCAAC
AAGCTCTGGCCCGGGAGATGTCGTATCCACGAAGGGATCCAAGTGGTACGACGTCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGGGACCAACG
GAGAGAGGATCCAGTCTGGATAGAGACGACGGATCAGAACATGGAAAAGGCAGAATCTCGGTGGATCCGAGCTCAACACGCATTCGTCGAACTGAGGAAC
AGGATCGCGACCACGCCTATCCTCCGTCATTTCGATCCGGAACGTCAACCTACGGTAATAGTTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTAC
AAGAACATGAGGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACACTGAAGCCGAATGAACTGAAATACGGAGCGGTGGAGAAAGAGATACTCGCGCT
CCTGCGCGTGTTGGATCTGAATTACAACCTGCTAGTGGGAAGATCCATCCGGATCCTGACTCGACACTCTACGCTAGCCTGGCTGTTCAAGTCGGCCGGG
TTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTG