Description :
From Genome Similarity Track
Location :
Scaffold_1066:753- 2245
Transcript NameFunction/comments
Phyke_g11487Amino Acid/Auxin Permease (AAAP) Family

Sequence
1492 bases(100 bases per row)
AACGGAATGCAAGAAAAGGTTTTGAGCAACAAAAAGTAGCTGGCTACGTGGACTAGTATACTATTGCGCTGCAATTAAAACTGGCACATGTAGCTTGATT
GTGCCGAAACACGACGCTGCTACGCGTACAAAGTTTTCTCTGGGCTGTGCAGCATGCCCCCACGATGCCATCGTCGAGGGGCCCCAAGTTGGGGACAAGT
TTGCAGATAGCTGGGGACAGATTTGCGGGACCACTTATGGATCCGAGTCCGTTTTACTCACCGTTTGAAGTGAGCCCGGCCCTTCTTAGCTCTTCAACAT
GACACTGATTTTGACAGCACATACAGTACATCGTACGGTATCGGTCTGCTGAGGATTTCTGAAAGAGAACTACAGCTCATCTCTCTCTCGTTCCTACTGC
AAGGGTCTATCCGATAGCAAACAGATAGTATCGGTTGGTAGCGTTAGCACCCCGGTATGGAGTCCGAAGCACAAGATGTTTGAAATGATCAAATCGCCCA
CATGGAAGCTCTGATTGCCAAAACATCCGGTTGCATGGTATCAGCACCGGAAGTGCAGGTCGCTTCATTCGTACTGATAGGAAGGCTGCTATACACACCG
ATAGTATGATATGTGTCCGCCTCACTGAGTCGGACTCCAGGAGGGGGATGGGGAACGCGGTCTTGAAAGGATGCGCTTGAACAAGTCTCCGTATCTCTTT
CGAGGTGTTCCTATCCCTTGACACGCATTATGTCGCTTGGGTCGCGACTTGTTATTGTCCGGTTTGACGCTCACTTGTCCCTAGATTCTCAAGCCGAGAA
TTGTGCTGCCGTCTACTTCGTATCTCGTTGTCATTTCCACATTTGCTTCGGGGCCCACACGACTTGAACCCAGCCACCCGCAGCACCTCCGTCAACCGCT
GCGACTGCCTCGAGTTCATCATGGGTTGTGGCAAGAAGTTTCTCACGATGGAGGACCTCAAGATGGTCCTCAACATCTTTTGCTGCGTCTACGGCATTGG
TACGCTTGGTATGCCCGGCAACTTTTCGCGCTCCGGCCCTGTGTTGGCCGTTGTCGGCATGGCTTTCATGGCCTTTGCCAATATCTACGCGTCCGTGGCC
ATTTGCCGCGTGATGTTGCTCGCCCCTAAGACCGTCAAAACGTACAGCGACCTGGGAGAGTGGTGCATGGGCCGGTGGGGCCGCTGGCTCGCTGTCATCT
CGCAGATGGCCTCGTGTCTGCTGGTGCCGTGCGTGTTCCTCGTGCTGGGCGGCACCCTGCTGGACGGTCTGTTCCCGGAcgccttcagctccagctacTG
GATCTGCTTCATGGCGCTCATGTGTCTCCCCGTGTGTCTCATCCCGACTCTgaaagaaggagctgccgTTGCGTTTGCCGGTTGCGCTGGCACACTCATC
GCCGACGTCATCGGCGTGGCCGTCGTCATGTACGGTATGCGCGGCCACCCGTCCGTGCCATCTCCCGAGCTCAAATTCGAGCAGGTCGCGGG