Description :
From Genome Similarity Track
Location :
Scaffold_1860:753- 1892
Sequence
1139 bases(100 bases per row)
TCATTATGGTTACCCTATTATGGGTACACTCATCAGGATCCAGGTCGCTTGGATCCACTTCACTTGAAAGTGTACACTCGTCGTGGATCTGAGCTCTCCA
CTCATCCAACATCATCTCGCAACCGTCTGTGATCTCCACTGTCCCACGAAAGTTCTAGATCCACTGCATCCCTCATCCCTATACCCTGGATCCAGGTCCC
TTGAGGCGGGATCCTCCCTCCTTGGATACGAACTCAGAAGTATGGGATCCGGGGTACCTCGCGGTGGATCTTGACTCTTCATTAGCCGTGGCTACTAGAT
CCACCGTCAGAGGGCACCTACCATCCTTCCTTCATAGGATCCACACCCGATCCACTCTTGTATAGTATATCCCATATCCATTTAGGTGAATCCAAGTAAG
GGTGGATCCGAGGTAAGTCTTGGTGGATCTTGCCTTCTCGTACATCGCTCATACCAGATCCATCGTCACTTCATACGGGGCGCTGCTCGTCATGGCTAAT
CCACCACCGGCAACTTGCATCCGTGCCAGCCAACCCAAATCCTCTCTAATCACTTGAAATTGTCATTGATTCGGGATAGTGACCCCGCGTTAGGCCCATT
CTCTTATTTCTGAGAAAGCACTTTACCACACCACCGCCCTGCCACCGCACTACCCAAGCCCTGCCACCGTACTGCCACCGCCCTACCGCCGCATTGCCAC
CGCACTGCCGCCGCACTGAGACCGCCCTGCCACCACCCTACCACCGCTCTGCCGCCGCACCGCCGCCGCCTCCCTCCTTTTTTATGAATACATTTTCGAT
GTGGCCCACAGTTAAAAAAGAAAACTTAATAAATTTGTTTTAAGGGCTACTGACTTAGATGCACCACCCTTTTGGTACAGGTCGGAGATTGTCGGAGGTC
GGAGATTTTATGTTATGGTTTGACAACCCGAGAATCTGGGTGCACCGTCTGTGTTAGGGCGTAGATCGTACATCGACGACATCCTACTTCGCGCGGAGTC
ATGGCATCGATTATGTGAACGGGTCAATGATTTACTGGAGGCGTGTAACAAGTAGAATCTCTCAATCAGCGTGGGGAAGGGCTACTGGGGTATGCGCAAG
GTGGTTTATTTGGGACATCGGGTGTCTAAAGATGGGCTA