Description :
From Genome Similarity Track
Location :
Scaffold_70:75299- 77856
Transcript NameFunction/comments
Physo_139077PREDICTED: solute carrier family 5 (sodium/glucose cotransporter), member 1 isoform 1
Physo_157918predicted protein

Sequence
2557 bases(100 bases per row)
TTGATCCTGTGCCTCGGCTGGATCTTCTCCCCCATTTACCGCCGCTGCGGCGTGTACACGACTCCGGAGTACCTCGAGTACCGCTTTGGTGCTCCGTGCC
GTCACTACCTGTCGCTCATCACGGTCATCATGTACGTCTTGACCAAGATGAGTGCCAGTATCTACGGCGGTGCCATCGTCTTCCAGGCCACGTTGGGCTG
GAACCTGTACCTCGGAGCCGGCGTCTGCATCTGCCTCAGCGCCATGTACAGCATCGCCGGTGGTCTGCGCGCCGTCATGTACACGGATCTGTTCCAGATG
TGCGTCTTCACGCTGGGCGGCCTCGTGGTGTTCGCGTACTCGGTGAACCAGATCGGCGGGTTTGAGGGCATTCGGGAGAACCTGGACAACCAGGACCGTT
CGGGCTGGTTCCACCTCTGGAAGCCGACGGACGACCCCGACTACCCGTGGACTGGAATGATCTTCGGCCAGCCTCTGGGCTCGATCTGGTACTGGTGCAT
GGATCAGGACCTCGTGCAGCGGGTGCTGTCTGCCAAGGACACGGCCAACGCCAAGGCTGGCTGCTCGTTCGCCAGTATGCTCAAGGTGCTCCCTCCGTTC
CTGATCGTCATCCCCGGCATTATTGCCAGCATCTACTTCGACTTCAGCAAGATTGAGGACGGCACCGATGCGGCGTACCCGACGCTACTGACGGAGATGA
TGCCGCACGGAATCATCGGCCTCATGATCTCCAGTATCATCACAGCTATGATGTCGAGTCTGGCCTCCGTGTTCGCTGCCGGCTCGTCGGTCATCACCAA
CGACATCTACCTCAAGTTCCGCCCCGATGCGTCGCACAAGCAGCTCGTGTGGGTCGGTCGTATGAGCATCCTCGTCTTCGCCGTGCTGAGCTTCTGCTGG
ATCCCCATCATGCGCAACGGAACGGGTCTCTACGAGCAGATTGTCGAGATCCAGAGCTATCTGACGCCTCCTATTGGTATCGTGCTCGTGCTTGGTGTCG
CCTGGAAGCCGACGAATGTGTACGGCGCGTTCTCGGCTATGATTGTGGGTGGGCTGCTTGGCTTCTCGCGCCTCATCTTCGTGACGATCAAGGACGACAG
CATGGACGGAGACCTGCCTGGCATCTGGAACACCTTCTTCTACATGAACTTCCAGCACTTCGCCCTGTTGCTGTGGGTCACCGCCATGGTGGTGTGTGTC
GTGGTGAGTCTTCTGACGCAGAACAAATGCCCTCCGAAGGAGGACGTGCGCAAGTACATGATCCACTGGGACAAGGTCCTCAAGCTCGATGCCACGGAGC
TTGTCAAGCCCATGTGGGTCAACGTCCTCGTTGCCGGCAGTGGCATTGCCGCTCTTGCTGTCACGTTCAGCATGTGGATTTACTTCGCGTAACTTAGGCT
GCAACACAAAGAGCTGTATGTATCATCGGTTGCTTCAACCAAGCAAGCACCATGTAACGAGGTCAAATATCAGTTAGTTTTTCATATCGACCAAAGTGTT
TTCCTGCTGCACCTTCACTCAATAGCTGCAAGTGGTGAAGCAAGCTCCGCCTTCTCGACTTCGATATACCCGTCGTCTTCAATACTGGCAACGAGTTGAG
CGTTGTTCATTAGTGCAATCTGAGCGCTGAACGAAGTGTTCGTGGCAGTGACGTCAAGTAGCTTGGTGCACTGAATGGCTTCACGAGACGAGAAGTGCGG
AAGCAACTGCTCTAAGCTCGTCGTGTACACCCCCGTGGCATTATGATAGGCGTGTTGGGCGTAGTAATACTGGAAACTGACATACCGCACTCCCCATTCA
GGGTCGACCGGCACAACATCTTCGCGCGCTAGAGATGGCGGGCTTTCGTCTCGAGGGCGAAACTGAAGGTATCCCCACCACTCAGGGCGGTGCATGTCGA
CGGCATGTTGCGCGCTCCAGACCCAGTTTTCCTCTTTTAAGCCAGGTTTCTTCTCGTAGCGTTGCCTTCCAGTCTGTCGGTCGGTGACAACATGGACAGA
CCACTCGACTCGTGAGAAGTTGATCCGCCAGAAGGAGTTGGCGATAGGTGGAACCTGCGCCTTTGAGTGCAAGGCAAGTTCTGACAACGGCAGGGCGATC
TCTACCGTCCAATAGTGCAGACGTTCAGCTGCAGCACAGCACGCACATGGACACTTAGCTACAACGCCAGTGTCAACATCGTAGCAGGTCGCTTGTACGT
ACATGGGTCATTGATCTGGCCTTTCACGAACACTGCCGAGCGCATACCGCTGTTCAACATGTCAAATCCATACTGAGGGTCCACTCGTGTGCTGTTCTCG
TGGCCTCCATCTCGGTACGGGCGGTTGAGCCACAGGTTCCAGGTTGCATTTCGAGCATTGAGCTCGAACTCTTTGTAGTTGTGCGTGCTCCCGTCGGCAT
CCACGAAGACCTCGAAGTCGTTGTCGTGGAAAATGACGTCGTTGCGTTTTGACACATTGGCCCACACCTCGGTCTCCTCCAAGTACGCGCCGACGTAGAG
GAACTGCTGGTCGTAGCGCAGCTTGAACTTGGTGGCGAACCACGGCTGCGACCAGAA