Description :
From Genome Similarity Track
Location :
Scaffold_107:75297- 81959
Transcript NameFunction/comments
Phyci_95912callose synthase, putative

Sequence
6662 bases(100 bases per row)
GGCCACGGCGAGATGGACCGGCGCCGGCGCGCCAGCTCCAACTACTTCGAGCTGGACGCGGATCGGCGCCGCAACAAGTCGGAGCGCTCGGAGCGCTTCA
GCAAGCGCCTGGACACGATGGACGTGACGCCCGCGAGCTTCAAGGGCGCGTCGCTGGACGACGAGGCCGCCGTGGACTACTGCTGCGAGTTCCTCAAGGC
TAAATTCGGGTTCCAGGACGGGTCGGCCAGCAACCAGCGGGAGCACGTGCTACTGCTTTTGGCAAACGGCAAGGCGCGTTGCCTGCCGAGCGACGCGGCG
GACCACCATCTGGTGCAACTGGCGAACAAACTTTTCAGCAACTACCGTTCGTGGTGCAAATTTATCCACACGAGCCCGGTGACGTATACTGGAAGTGGCA
TCCCGAACTCTACAGGTTCCGGCAATCTGCACATGGACGTGATGCTGTACTTCCTCATCTGGGGGGAGGCCGCCAACGTGCGGCACATGCCCGAGTGCGT
GTGCTACCTGTTCCACCAGATGCTGACGCTCGTGAACGCCGACCCGCAGGGCCACGAGCGCCAGCGCGAAGGCTGGTACCTGGAGCAGGTGGTGCGCCCC
ATTTGGCGCGAGGCCAGCAACATGAAGCGCCGCAACGCGCTCAACAAGCCGCTGGAGCACGTGAAGATCCGCAACTACGACGACATCAACGAGTACTTCT
GGAAGCAGCACTGCCTCAGCATCCCCGTCACGCTCGTGGGCCAGGAGCTCACGCAGAACCACGGCAAGACCTTCTACGAGCACCGCAGCCTGCTCACGAT
GGTGCTCAACTACTACCGCATCTTCCAGTTCAACATGATGTTCCTCGTGCTGCTCACGGTGCTGGCCTTTGCCGTCACCATCTCGCCCGACGGCGGCAAG
AGCGGCTGGGTGCAGTTCGGCAGGATCGGAGACGTCGTGGACCCGTACACCACCAGAGACCTGAGGCTCGCCGTGGTCGCCATCCCCTTCAGTCTCAGCC
TCATGGCGTTTTTCAAGTGTGTCATGGAGGTGTGCCACGGATGGCACCTGCTCGTCTCCAAGGAGAGCTCGGCCACCAGCTCCAGGTCCTTCACCTACGG
GTCGGCGCTGGCCACGAGGATCATCTGGAACGGCGGCTTTGCCGTGCTCTTCGGCACGATGATCTACGTGCCGCTGAACCAGGACAAGGACACGACGCTG
CTGGACAATTTGTACCCGCTCTGCGGCGCCTACATCCTGCCCGGGCTGCTCGTGCTGCTCACGCAGGCTTTCGCCCCCCAGGTGATCAGTGGAACCTTTG
CGGCCAAGTTCGTCAGGGAGGGGGAGAGCTGCTACGTCGGACAGGACATGACGCCGCCGTTCGCGTACCAGGTCAAGTACATTATCTTCTGGATCCTGCT
GTGGATTATCGAGGCCATCGCGTCGTACTTCATCCTGGTTCGGCCGCTGATGCTCCCCACGCTGAGCATCTACGCCATGACGCTGGACTACCAGAACTCG
CTGGTGTCGTTCCACAACATTGGCATCATTATCGCTCTGTGGCTGCCGGTGGTGTTCATCTTCAACTACGCCACGCAGATCTACTTCACGATCTTCCAGG
CGCTCCTCGGTGGGTTCCAAGGTATTCTCATGAAGACTGGTGAGATCCGCGGCGCCAAGGAGATGACCAAGGCCTTCCGTGTCGCCCCGCAGTTGTTTGA
CCAGAAGGTGGTGACGCTTCTTGCCCGCTCCAGCGATGCCACGGCCAGCGGCACCGACTCGACTCGCGCCAGCGCCATCGCTGCGGCGTACGAGTCGCAG
ATGATGCTGCGTTTCGTCGTGGTCTGGAATGAGATCGTCAACTCGTTCCGCGAGGGTGATCTTCTGGATGACAAGGAAGCGGCTATTCTCCAGTACGACA
TCCGCAGCACCGGCGAGGTGTTCGAGCCCGTATTCCTGTCGGCTGGCAAGCTGACGGAGGCCATGAACCTCGCCATCAAGACGGCCAAGGACGGAAAGGG
TGAATCCCAGCTCCGTGTGACGCTTGTTGAGAACGATTGCCTCTCGGCTATCCGCTCGTTCTTCACCGCCAGCATGTACGTCATCAGCGCTCTGTTCGGC
AACGATGACGCCGATGTTATCGACGGCTTCCGCATGATTGAAGAGATTGCCGCTAGCGGCGGCTTCTTGAAGTCGTTCAACGTGCGTGAGCTGGCCAGCC
TTCGTGTTGCAGCCGTTGACCTGCTCGAGGAGATCCTGGACCTGCCGGACCCGGACGTTCAGTCCCAGCACATTCCCAACGCGCGCGTTCACTCGATGGG
TGTGATCCGTAACTTCGTCTCCAAGATGGAGGCGTTCCTGAACGGCGTGCAGTCTTTCTGCGTGGACCCTGCTCTCCAGCGCAAGTTCGGCAACTCTAAG
TTCTGCTCCAGCGCCAACGGATACATGTTCGCGTCGCGCGGACTGGTGAACTTGTTCTGCAGTGACACGGCTATGGGCGCCGCCACGCGTGCCTGCCTGC
TGCTGTCCCTGGACCGTTCGGAGGCCATGCCGCGCACGACGGAGGCACAGCGTCGTCTGGGTTTCTTCATGAAGTCGCTTGTGATGGACATCCCGCAGCT
GCGTTCCATTAAGGAAATGCGCAGTTTCTCGGTCGTGACTCCATTCTACGCCGAGACTGTGCTGTTCTCGCTCGAGGACCTGAACAACCCGCTTGTGAAC
CACCCGATCTTCCAGCAGGTCGAGGAGGATGGCAAGAACCTGACGATTTTGAAGTACTTGACGAAGATTCACCAGGAGGAGTGGGACAACTTCCTTGAGC
GTGTGGATGTGAGCTCTGCTGAGGAGGCCCAAAAGAACCACCCGGAGGAGATCCGCCTGTGGGCGTCGTACCGTGGTCAGACCCTGGCGCGTACGGTGCA
GGGCATGATGATGTACGAGGATGCGATCAAGATTCTGCACTGGCTGGAGATCGGCTCGAGCCCTGGCAAGACTGCCGAGCAGAAACAGTCTCAGCTCCAG
GACATGGTTCGTCTGAAATTCTCGTACATTTGCGCTTGCCAAGTGTATGGAAAGCACCGCGCGGAGGGTAAGGCGCAGGCTGACGACATTGACTACCTGC
TGCGCGAGTATCCCAACCTGCGTGTGGCGTATGTTGACACTGTGGTGCACGAGGACGGCGAGAAGTCGTTCGACACTGTCCTGATCAAGAGTGAAGCTGA
CGATATTGTGGAAGTGTACCGTTACTCTCTGCCCGGCGACCCGATTCTGGGTGAGGGTAAGCCCGAAAATCAGAACAATGCCATTCCGTTCACGCGCGGC
GAGTTCGTGCAGACTATCGATATGAACCAGCAGCACTACTTCGAGGAGTGTCTGAAGATGCCGCAGCTCCTGTGCACCGCTGATCTGCACCCGTCGAAGA
AGCCCGTGTCGATCATTGGTATGCGTGAGCACATTTTCACGGGTAACGCCAGTTCGCTGGCCAAGTTCAAGACGTGGCAGGAGCTGGTGTTCGTGACGCT
GTCGCAGCGTGTTCTGGCCGATCCTCTGTACGTGCGTATgcactacggtcacccggatgtgttcgacaaggtgttggctatcacgcgtggtggtgtgtcg
aaggccagtaagggcatcaacctgtcggaagatgtattcgccggtttcaacacgacgctacgtggcggtgtcgtcactcacgtggagttcatgcagtgtg
gcaaaggtcgtgatgtgGCTCTGTCGCAGATTTCGATGTTCGAGGGTAAGCTGGCTAACGGTGCCGGTGAGACTTCGCTGGCTCGTGAGGCCCACCGCAT
GGGCCAGTTCATGGACTTCTTCCGCCTGAACTCGATGTACTACTCGCACACGGGTTTCTACTACGCCACGTGGATGACGATTGTGACGACATTTGTGTAC
ATGTACTGCAAGGTCTACATTGCCCTCTCGGGTGTGCAGACGCAGATCGTGTACAACATGAACACGACGGAGATCATCATGGACAACTCGGAGAACTATG
GCTTCGACGACCGTGTGTATCACGACATGGACTCGGTGTACAACACGCAGTACTACATCCAGGCTGGTCTGTTCCTGTCGCTACCGCTGATTTGTGTGTA
CTTCGCCGAAATGGGTCTCCGTCGTGGTCTTGTGCAGTTCTTGGAGATGGTGTTCACGGCAGGTCCGGCGTTCTTCATTTTCCAGTTGGGCACGACCATG
CATTTCTTCGACAACAACTTGCTCCACGGTGAGGCCCAATACAAGGCTACGGGTCGTGGCTTCAAGATTACGCGTGAGACGTTCGTGCTGCTGTACAAGG
CTTACGCGCCGAGCCACTACCGCAAGGCCATGGAGTTGATTGGTCTGTGCTTGGTGTACTTGTCGTTCGGCAAGTTCGACATTTGTGATACCTCCGTTGC
TGGCGAGACGAACTCGTTTGCTTTCAAGTACTGTGAGACATCGCAGAGCTTCGGTGTGCAGACGTTCGCCATTTGGGTCATTGCTGTGGTGTGGCTGCTT
TCGCCATACATTTTCAACACGGATGGTCTTGACTGGGAGAAGACCAAGGCTGATGTGTCGGCTTGGGCCAAGTGGATGTACGCCGCTGAAGACTACCAGG
ACGAGGATAAGGTCATGGTTGGTGGATGGATCGCTTGGTGGAAGGATGAGCTCAGCTTGTACCACAACACGAAGCCGATTGCTCGATTCACGGTCATCCT
GCGTGAGGCCCGTCACTTCCTGCTTATGTGGTACGTGGTGGCACTTGAGTGGGAAATCCTGACGGTCGGTCTGGTATTTGGTGCTGCTGTGGTTACGGTG
CTCGCTATGGGCCTCTTTGGTGTTGCGGGTAGCTGCTTCCGCAGCGTGAACTCGTCGATCCGTGCGATGATGTATCTGTTCGTGGTGGTGGTTGCTCTCA
TTGTGTTCTTCGTCGCCACCATTGTGATCTCCGACGTCAGCTTCACCAGGACCATTTCTCTGTTCTTCGGCTACATGGCGGCTCTGTACGGCATCAACGA
GATGGCTCGCATGTACAGCTTTGCCAACTCGTCTATTGCGACTGTGGGCATGTTCCAGCAACTGGCCTTCTTCTTCGACTTTATCTTCTCGGTGGCTATG
ATTGTTCCGCTCCTGGTGATGTCTGCGATCCCGTTCTTGAACATTATCCAGACTCGTATGATGTATAACAAGGGTTTCTCCGAGGTCGTGTCAGCCTCGT
CGCAGTACGCGTTCTCGCTGGCTGCATTCATGGGTATGCTTGGCGGTATCGGCTGCGGCTGGCTGTTCCACTTGTTCACTACGATCGAAAGTACTGCTGG
ATTCCTCAGCTACGTTACGACGTACGATCTGCTTGACGGCAAGGTCGGCGACGGCACGGTTACCTACGCCTTCTACTTCGCTTGCATCGTAGGCGTGTTC
GTGGCTGGCTTCCTGAACTACTTCATCGGCCGTCGTCTGTCGATCGTCTTCGGTGGTCTGCTGACTGTCCTGGGAATGCTTGGCGTGAGCGCTGTCCAGA
CCGGCGGCGAAGGCTTCCTGCTGCCTGGCATATGCTTGCTCGGCGGCTCCGTGGGTGTGCTTCTGCCAACGTTGGCGGTGTACATTTACGAGATTTCTAC
TCGCGACATGCGTGGTAAGGCCCTGCTGCTTCTTGGCAGTGGCTTCATTCTTGGCATCCTGTTTGCCGCCTGGTTCTCCTCGTCGTCGAATGAGGTGGGC
TGGGTGTGGCAGGTGTTCATTGCAACGATCATCCTGTCGATCATGACTCCGGCGGTGTACATCTTCCCGGAGAGCCCGTACTGGGTGTACATGCGTGAGG
GCCTGGAGTCATGCGAGCGATGCCTGGCTGTGCTGCGTCGTAAGGAGGGCGTGTCTGAGGAGCTGCGCATGATCCGCGACGAAGAGGCCGGTAGTGACGA
CTCGAGCGCCAATGGCGGAACCTCGTTCCTCAAGTTTGTGATGGGCCTGTTCTTGATGCTAATTTCTGGCATCTTCTTTGGCTGCGTGAACATGTACCTG
TCAGACACGTTCCGTAGTATTGAGGACGCGACCTACATGTTCGTGAACTGCACGGGTCTGCAGTTCCTGGGTGCGCTGTTCTCGTTCTTCTTCATGGACC
GCATCGACCACAAGCGCATCCTGTTCTGTACGTTGCTGCCGATTGCTGGTCTTGTGTTCGTCCTCGGCCTGAACGACAAGTCGGAGTTCGTGACGGGCGA
CAGCGAGTACCTGATGCTGCAAATCGTGGGTCTGCTGCTGTACTTCTTCGCCGGTCTGGGCATCACATCGGTGCCATGGGTGTCGTGCGTCGGTCTGTTC
ACCACTAAGCAGCGCGCGGTGTACGTGACCGTCTACTTCATGCTGTTCTTCCTGCTGCCGGTATGCTCGACCTACATCCGCTCCAACGACTCGATGAGCG
GCGACGAGTACTTCTACCTGTTTGCCTTGACCGGCTGCTGCGTCGTAGCGACGGTGCTTCTGTTCGCTGTGGGCACGCTCAAGAACGGCATGGTGTGCAC
CAAGGGCGAGATGGAGGCGGAGCGTGCGCGTCTGCGCCGCATCCGGGCTTCTCGGCGCAGCGCTCGCACGCCTGGCAGCGCGCGCTCAAGAAACTTCAGC
CGCTCGCGTGCCAAATCGCACTCGAACTACCAAATGTACGAGTCGCCTGCTGGCAGCGCACC