Description :
From Genome Similarity Track
Location :
Scaffold_32:7529- 16536
Transcript NameFunction/comments
Phyke_g1815hypothetical protein PHYSODRAFT_557610
Phyke_g1816hypothetical protein
Phyke_g1817hypothetical protein
Phyke_g1818chromodomain protein, putative
Phyke_g1819vacuolar protein sorting-associated protein 8

Sequence
9007 bases(100 bases per row)
TACGATACTGGCTACGGGGTGTTACGTTTGGCTGGCTAATGTGTTTTTCTCCTTGtgtgtgctgcagttcaagctCATTCCCGATCCGTTGTCGTGCACT
CCTCGCGCCGTGTTCCTCCCGACACTTTACGACATCCCGGCCTTTCTGGCGCGTTTCATTGGACgtagtcaagtcgagctgTACCCGATTCAGGTTTGCT
TTGCTTGGACAGCTACTCATTTCTGTCTGAGAGTAAATCACTGACGGTTGTTCTTGGCTCTATACAATCTTGACAGCTTCATTCCATCTGGTTCTCGATT
TTCGCGTCAGTCGTATCTCCCTTTGGAGGCTTCTACGCTTCGGCTATCAAGCGCACGTACGGCTTGAAGGATTTTGACTCTGTCATTCCTGGCCACGGCG
GTGTCATGGACCGAATGGACTGCCAATTCATCACGATCTGCTTCACGACGGTCTACTTCAACACCTTCATTCGGTATGTCCAGTTAGTTGCACCCTTTTG
ATACGTTTGACTTGAGCTGACGGTTGGTATGGACGTGTTTGTTGTCATTGATGTGTGCAGTTCGCAGACCCCGTCCGTAGCGATGATTCTGAATCTTGTG
ATGCGGCTGTCGGTCGACCAGAAGCAAGAACTGTTGCAATCCATCCAAAAAATGCTTCAGGGCTGAGACTTTGATAGCATTCGTGCAGACATCTCGTTTA
GAATCAGAAGTCTTAGGAAAAATGACAAACGTGACGAAAAAGGAAGCCAAATGACGAACGTCACGTTGAAAAACATTGGACCACTTTTAGACCATTTTTA
GACCATTTTTATGTGGGGCACACATTTTGATTCTTATTGTAGCTTTTGGCCATAAAGACCTAACAATGGCCGCCACGGACGAGCGCTTCTGTCTGCGTGT
ACGGAACTTACCTGCCGTGTTATCCACTGAGGCTGTCACGTCCTTACTGTCGCATTACGACGCTGTCTGTGTCCGTGTGTTGCACCGTCGAGTACGTAGT
AATTACGTAGATCTAAACGTTTGATACAGTCCCTTTTTGACCATTATAACATTGTGAACGTAGAATATTTCAAGTGGAAAAGAACCAGGAGCGGTGGCAA
CTAAGAAAACACAAAAGGCAATTGCAGTGTTTAAGTCCCGAGAAGCTCAGCAGAATGCACAGCGGCGTTTGCACAATCTGGAGTTGGCTGGTCAACATCT
TCAGGTTCAAGTGgttggagatgaagaagaatcTAGTGATCCAGTCGAATTGAAGATGCAAAACGCAGGGATTGGTGCCAGATTGCCGTTAAATGGGATA
CCGCCATTGCCCAAGGGTTTACCACCACCATTACCGCCGATGGCAGTCCAAATGCCAATGCAAAATTCGTTTTATCCTCCTCCGGCACCATTGGCGCCAC
ATCTTGGGTAAGCGGTAGTGAAGATAAAACGGTGGAGTTGGTTTTAACGGTTGATGTGAGTATATTGTGGTACAGATTGAATTAtgcaccttctccactg
ctggAGTACAAATATCCGAAAGCAACAGAGAGCATTGTACGCAATATTGCTAATGGTACGTGGGAATGGTTTATTTATGAGGTCGTGGAACTAAATTGAA
GGTGTACATTTATGTGTATGTACAGCGCTGATAGCGTTACCTAGGTTTTACACTCAAGTGCTCCACCTCATGAATAAAATGAACCTCCCACCGCCATTCG
AAGAAGACGCGATTCTGGGTAGATTTTCCAAAACGCAAGAGACGGCCAAGCAGGAAGATGAACTCAGAAAGCATCGACGGCGACAACTGAAGCGTCCTAG
GAATGATAAAAGCCCAGATGTCCAGattgtcgaagaagacgacgatgaggagaGTAGTAatggcgatggtgatgtCAATGACCAAATCCCAACGAAGACA
ACCGACTCGCGTGCGCCATCTTTTCAAACGCTTGAGCCACCTAGTAAGCGTCAGCTCACCGAAGACAGAAGTAATACAAGCGAGACAATGAGGGGCCATG
GAGGGCCTCGTGATGACGGGCAACACCCTGTGATTATCGGGAAATCCTTGGTGCGACAGAATAAGCGATCATTGACCAAAAATTCCACGTCTACTCCAGC
ATTTCAGCTCGGGATTGACAATGGAAGCCGCAATGAAGCTCACCGATCAATGCGTCCAGGAGTTATTTCAGAGACGGAGTTGAACCGACAAAGACTCGCA
CCTGGAGGTAATAGGCACTCGCGTGAAATTACCCGCCGACTTATAGGAAAATCTTCTTACATGCTCCCTCCTTTATGTGGTCGTGGGAACAGATCTTCGG
ATGGAGCAGCTTATGACGTCCTACGAACGTGGGCTGCCATCGCCAGTTGTGATGGTGCAGAATATTGCAGAGACGGTGGACGAGAAAGACTTACGCTCAA
TATTCGGCTATGTCCTGCCGCTGGATGTGACTCTAGAGTGAGTATTTTGCTCGTACTAGGAGTTTGAGCGCGcacaacttgaagttgacacAATTTCTGG
TGGCATTCGTTTTAGATCGGTGGTGATTACCTTTCTACCCGCAAAAGGTTCGGCTCTTGTAAGGTACTCCGACAAAGATGTCgcgtcaacagcagtggAC
AAGTTACTTGGTTTCCAGATAGAGGGGAAGCCACTGATTATCGTACGGTAGATATGTGTCTCCCGTGGTGCTGCGTTGTAGGTCTTGGGCAAAATGACTT
GCTAAGCTTTTTTTTCGTATTGATGATGTAGAGTTTCCAGAAAGCAGAAACAAGTGAAAATGATGCCTCAAACAATGGCACAATAAAGCCTGCCGCACCA
CGCTGGACAACGCAGGACCTTGCTAGCAAACGTATGTCTGAATTGCAACTATCTGCGGAGAAggccatgaagaagtacgAACGCGGAGAATCGTCCGACA
CATTGTATGTGAAAAATCTTGCGAAATCAGTGGAAATGGCAGATCTTGTCGCTGTTTTTGGTTCTTGTTTGCCTCCCGAATCTGCTCCAGAGTACGTTTC
TAACAATTGTATCTTGAGTAGCCTCAACAGAGCGAAGGATTCTAACAGCTCGTTATCAACACTGCAGGGTTCTGGATATCCGTCACTTTACAACGGGCCG
GATGAAGTGTCAAGCTTTTGTCAAGTATCCTACGGTTGATCTCGCATCTAACGCCTTGCATCACGTGCACGGTGTTGTGCTGAGGGACAAACCATTGGTT
GTGGTATGTGCTCTCGCCTTGTCCTAACATATTCCTGTATTGATTTCTCACACCGTTTTACGTGTATCTGCAGTGCTTCCGTAAACCGCAGACAAACCAA
AAATGAACACATAACAGCACTCTTCCTTGCTTGATGAACTCtaatttcttcttctgtccCATCGCATCGAACTAATGCAATGTTTTGGAACGAAACAGCA
GTCAAGGAAGATCGCGCAATTTGGCttcgctgatgctgttgatcaCCCACAGATAATTGACAATAATCGTCGACGGTGCTACTCGAAGCTGCGGCAGCGC
TCTCAATTGTTTTGTTTGCTCGTGCAGTGCACGGGGGTTGAGCTTGTCTGACACGATAATGAGCTTCCGTGAGCGGGTTTCGTGCTTCCTCATCTCGTTG
GGAATGTCATCCATAAACGGGATGAGTTTTCCACCTCCCATGCATATCAGGGTGTTCAGCTCTGCAGTTGGCGGCATGGGCGGAAGAAACTCGCCGATAA
CGTGGAAAAAGAAGTCCGCAAACAGCATTGTACCGACGTCCGAGCAGTCGATCTGCAATAAAAAACAGACGCACATTAAAGGACTGAGATACAGAAGCAG
AGGGAATCTCATTTCAGGATCGACGTACATCTGGTGGGGacagctgaagaagcttctcTCGAGCTAGCCGCGACCTTCGGACAGCGTCGTGAATCCTCTT
TCCCTTCAAATGACCGTCAGCTTCATAATTCACCTCACGTACGTACCCACCGTGATCTGCGCATGCTGAGAGCAACAAAACAATCGAAAGCAAAATGTGA
GTTATCACAATCGCCATACACACAAGGTACCGAACGCACGAGATCACCTTGCAGCCACTCATCGCTTACGATCCATCGACCACCAACGAGAGCCTTGAGG
TACTTCAATGACCGGATCAGCACCCAGCGGCCTGactttgctggtgatggaTCGCTAAATAATTTACGCTTGCCTGTCTTTTGGCCCCGAggagatgacg
aagaatCAGTGTTACCTCCGTAGCCGTCttcagcatcgtcttcgccACCGTTCACACATTTTGCAATTAAGTGCGTCACGCGATTCGTCCAGCACtgaac
aacatcagcacctAACAGCTCAGCCCATTCATCTATCTGTCTCATTCGATCTTCCTTGAACCCAGAACACAAGAACACCATTCCTGGGCGTTTGGCGTTT
TTACTGATTTTTGCTTTCGTCTTGGTTGTTGAGTGTGGAGAAGTCCTAGCTCGACTTCTCTTTACAATCGAGACGTCCGGTGAACTGGCAATATCGGACA
CTCGTCGACGCTGACGTTTCTTGACGGCACGACTGGGTGTCGTGTCTAAAAGCAGTTCTTCAGTTGGTCTTCGAATGTAAAAGCCCGGCACGTGGTGTTC
CGTTCTGGGGCCAATCACGAATCTCACTCTGTACGTTCCATCGTTGTGGACCTGGATGATACGTGCTGCACCACCTGACTTATTGATACCGACCCATGTT
CGCTCGaccacgtccaccagctccCCCTCTTTGAACGTTTCAAGCTCTAGTAGTGgctgtgtctgctgcgttTGGCTATCCACAACTTGTGATTGTTCTG
TTGTCGCTCCATTGACGAccgctccagctccgttgACCGACATGAGCAGCTTTGTTTCTGTTTTCACCTGCACTGCAACTGAACCTGCATTTCCTGACGA
TCTCCTTCGTTTGCGTGGTGTCGGTGTTTGTTCAGCACTTGCCACACTCTTATCTCTCGCAGGGCTCCTCTTACCACGACGATAGGGGCTAGTGGCTTGA
ATCGCTGTCACCGCCTGTGCCTTCGCCGCTTGAGGAGCTTTGATCTCAAAAAGTGCAGGAGACATCGGCGACACTGGTGTCAAAGTACGTCGCGGAGATG
ATCTCCTTACAGgagtagtagcagcagcagaagcaacaggagaaaCTTCAGCAGATTCCACCGTGgattcagcagctccagactCAACAGTCGAAGTCGT
AGAACCATCCGTAGAAGTTGTAGTTGAGGCTGGTACTTTAGCAGTAATAACAGCTATAGGGACACTCTTAATAGCAGTATCTGGAGCAGCCAAAGCACTG
CTTATAACTGCTAAAGGCTCTGTTTTAACCTTATTAGGaatcttgatcttgttcttgacgtcctCCGTCTTCTCTGTTGGATTCTTCATTGTattctgct
tctccacagtCTCTGGCGGCCCACATAACATCTCTGTTGCCCGCATCAACTCCTGTATCATCGTATCATAGCGCAGTCTTCGTTTCTTGGCTGGAGTTTT
GCAGATTGGACACACGTCTTTGAGCTCCAAGGCGCGATGGATGCATTCCTCACAGAAGCAGTGGTTGCACGGCAAAGACACAGGATTGTCGTACGCGCAC
AGACAGATAGCACACTGCAGCTGTGTCGAGAATCCTTCCACAGCACGTTCCAGTCGCTGGAGCGTCCACAGCTCACGGTCCATTACCGCCCGTCGAAAAA
GTCAAATTAGATAATGACTAAAAAAGGTGATACACAAACAATGGATTAAACAAAATACATTTTGAGTAGGTAATATATAAAACGACAACAAATACAAAGT
ACTTAAAATTGTAGACTCTCTGAATTGCTAACATACAAAAATAGTTCACTTTCCTATTCATTTTTACCATGTCACTGGACGAGTCTTCGGTCCTGATGGA
CCGCGCTCTGGTGACCATGTGCGTGGATCTACCAGAGTCTCTGGGGCTATATAATACTGCCAAGGACCAGTTATCTCTGGCTGCAATCCGTGCAGTGccg
ttgctggagactgTGGGTCCCGATTCACGTAAGTTGGCTCTGATTAAGGATTGGATGAAGACTTACGAACCGGGTGAAGATCAGCCGTTGACGTCGGAGA
TTCATATGGATTCTCTAAAGGAGACGGACAAACGTGAACGGAAAGAGCGagcacgacagcagcaggtggaaaAGCACGCGCTACTGACAtcagaaggagg
tgaaggaggggacaagcgcagcaagaagaagaagaagaagaagaccaaggagaagaccaaggagaaggagaagaccaagaacaaAGGGACAAGCAAAgag
atggccaagaaacagaagagcagcggcagcaaaaGTGTACAGAAAAACCATGACTTGGcggacagcgacgacgacgtgctgtATATTGAGGACTCGAGTA
GCTCCAGTGAAGAGTCTTCCAGCGAGTCTTCCAGTGACTCGAACAGTGATGACAACAGAGGCAAGAAACGCAAAAAGTCTACGGGTAATTTACCTCCCAA
GGAGACGGTGTTGTCCTcagatgaggacgatgagcCTAATGATATGTTTGACACGGACGACCCGGACGTGTATGAAGTGGAGAAAATATTGAGTAAGCGG
CCTAGTGACGGCTATGGACAGCCGGACTTGTACGAGGTCAAGTGGGAAGGATATGACGAGACGACGTGGGAACCAGCTACCAACATCTCCAAGGACTTGA
TCGACGAGTTTGAAGGACAACCGGTGCGGGAGGACGTGTACACTGTGGAAGATATCATTGAccgcaagagcaagcgcgACTCCACCACGAGGCTCAAAAC
GTATCAGTACAAGGTTAAGTGGGTCGGCTACGACGACCTCACGTGGGAACCTGCCGAGAACCTCCCGCACAACTTGCGACGGAAGTTCGACCAAAAGTAT
GAGAATCGGAAGCGTCGACGAACATGAGGAGTAGACTACGGTGGGGCTAATGGTGTCATGAACACACGGTGCGACTACGTGGAATGCGAAGGTCCAAAAG
ACAATCAACGGAAAAGAATTGGTAAATCTTACTGGTATGGGCGTTAGTTGGGTTAATTAATTCTCTCCGTGCTACCGTTTAAAAGATACGTTGAAATACA
TGAAGTGATGTTATGAACACCCTCTGCGGGCAATGCACCCATTCCTATCGCTAGTGTAGCCATGTAAAACTGGACATGGCTACACATGAGTATACCGTAA
CCATCAAATATACTTTTTCTGCTACAAAACtcaatatatatatatacTTTTGTGTATAACAGTATTTCTATTTTATCTGAAAAAAATCTGTTTTTTTGAA
GAGGGGGGAGTACACGAAGAGAACACTGAGCCAAAAAGAAGCTGCGGCGTCTCGCTTGGGGAGGCTCTAGCGCACACTACACCCCACCAATCGACCTATC
CCCACGACCATCTTGTTCCCCAGTGCTCTGTCCATCTCGTGATATCTTTTTATCAACTTAAAACACTCTGAAACCATGAGTGGCGTCgagagtttgctgc
tggatagtgacgacgaagacttGGGAGACTTGGATCTGTCCGCCATTacgctggaggagattctGAGGGAGGAAGAGCTGGCAGCCAAGGGTCAAGATGG
AGAGGGAGGCTATGGCGCCTCAAAACAGGACACGGACGATCTTTTTTTCGCCCCAGCGACCTTCACACTGAACATTGAGCCAGGCCCAGGCATGGACGTG
GTACCAGCAGCTAAAGCGCCGACCCCAGCTGGCACCAAGACGGAAACGCAGTTCCGGACGCCTCTGGAGATCGCTGAAGCTCGGGAGAAGCAGCTACTGA
GCTGTGTGGGGGTGGAACTCATCTCTCCATTGCAAGTGAAGCGTCGTCTACGAGCTCATGCACGATCTAAGGCTCTCAAGTCTAGACACGATGGTGTGGT
GACTACAAAGAAGAacgagaggaagaagaaaattgCAGAGGGGACTGCTGTGAATGCAAATGCAGAGAAGAAATCTACAGGAgtggtgaaggtggagcCC
ATGGAAGCCATCAGTCGTCAATTGAGGAAGAATATTGAGTTCAAAGAGTATGGCCCTGGGTCTCCGACTGTGGTGGCGATCCACTCCAAGTTCATTGCCA
CTGGCACGTCCAAGGGACTGGTTATTATCTTTGATCACTTCCAGAACGTACGTTGGAAGGCAGAGCAATTGGTTGTTAGACTTGCTATTGACTTTTTTAT
TGCTATGGTTTGACAGATCCGACAAGTTTTGGGGAACACGAACGATGCGGATAGTGACGGACCAGTGACGGCAGTGGATGTGTCACCTGGAAGCGACTAC
TTAGTGTGCGGGTACCAGAGTGGACGTATTGTGTTGTGGGATATGATCAAGGGCACGTCGCTGAAGGCTGTCTCGGATGCCCACGAGAATCCGGTTGTGA
GTCTGCGTTTCCTCAAGGACCAGAAACCTGTTTTGGTCTCGGTGGACACCAATGGTTTGGTAAACAAGCTGAACTTCTCCAAAATGATGGGAATGGTGTA
TGTAGTAGATGTGGATCCACTGTACGACGGGTCGGCAGGCAAGATCCTATCGATCTCCGTGCTGCCGCAGTCCGCAGGCAATGCCAAGATCTCGTATCTG
ACGGATCAGTACTGCCTTGCGGCGCTCAGCAGCGAAAAGGTGActttcatcatcgccattGAACCGGAAGTCCGTGTGCTGTACCGATGGGCACGTCCAG
ACGATATTGCGCCAGACGACCCAGTGCTCCCCTCCCTAGCTTTTGCGTGGATTTCTTTCCCAGGGAGCTCTCGAGCTCTAGCGCCAGTGCTTGCTCGTGG
TTGGGGTAACCGCGTACAATTCTTGGAGGTGGTATTCCCAGGCGGTAAAAACCACTCCCATGGGCGTCACGGATTCCCAACTTTCGATGAACACGACCAA
ATCGAGTCCTCGAGCGCTGTAATGGCTGTGCAATGGTTGGGTGACCAGGTCGTGGTGTACCTGAATTCACACGATGAGATTTGTGTGTACGATGTAATGT
CGCGTCA