Description :
From Genome Similarity Track
Location :
contig_18:752852- 755585
Transcript NameFunction/comments
g3808.t1hypothetical protein

Sequence
2733 bases(100 bases per row)
ACTTCACATCCAGTCCACCCTCGTGCTATCTGCAGGGACCCACGGCACCTCCAGCCAACGCGTGACGATGACAGATCCACCTTCTGTGGTCCGCCAAGTA
GTGAAAGAGTTCCAGGCCCTTGGACCCTTCGAGTTGGTGCCTCCACGACCTAAGGAGACTTCGTACATATTCAAGTGGGGGGTTCGTGTCAAGTACATCG
AGAACGAGAAGGAGGTCTTCGCGTGGGCTTGTTTGGCCGACGAGGCGTTTCGGACGTCAGGAAAAAACCTGCTCAACTGCACAAAACGACCATGGCCGTG
AAGCACCTCCAGAAGATACACAACGTTGGTTCGCCGAAAACGGAGACAGCGACCGTCAAGAAGCGCAGACACGATCATGGTTACAGCCACCTGTCATCGT
CGCTCTGTACTCAATCAACCCAACCCGGCTAAACGTGCCGATGACCACATCAACCATAACTTGACATTTCGCATGGTGGAGTACGAAGAGGCAAGACTAA
TCCAAGCGCTACTCTATAAGGACGAGATGAAGGCCAAGATAACTACAAAGCAGGTGAAGGAATCTATCGTGGAGCTGTATTCTTCAACACGCAAGGAGAT
CACTAACTACCTCCAAGAGAACCGAGAGGACTACCCGAACTTTACGCTCGTGGCAGATTTTTGGACTTGCAAAACAACGCAAGACAAATTTCTTGGGTTG
CGGGTTTACCTGGTGGACAAGGCCTGGGAGTACAAGTCCATTCTCTTGGGAACGAGAAAGTTCAACCCCGCATATGGAGATCGTGATGGCGGCATTGTCA
AGCCCTTCAAAGGGTGGTTGAAGCACATGCTCGAGGACTTTGGCTTAGCGACGAGCGATTTTACGGGGCTACGAGCGACTCGGGGGGTGACGTGAAATCG
ATGCTGTGCAAAGAACTCAATCTGCACTGGGAGTGGTGCTTCGCACACATGGCCCACGCAGCTACAAAGTCATCATGTGGTGTAAATGGAGCTGCTAGTG
CTGCAGCTAACCCGGAGATGGCGGACTTAATCTCACGGATGGTAAGAACAATATTTCAGGTCAAGGTCGTGTCTGTCACTGGGAGCTTATTTGCAGAGCT
CTGTAAGTCTAAGACTCAGGGTGCCTCCACGCGACTTGTTGGATATTCTACTTCACGTTTCCTGAGCATGACGCGTTCATTGGAGAGAGTTCTTGAGAAG
TGGCCAGCAATAACTGCGTGGTATGAAGAGCGAGCTCGTAAAGCACTTCGTGCCAACCAGCCACCACCAGAGTTCCCGTTGGCTAATCGCCATGACGACT
TGGTTCATGTGTTGTCTGTGCTGAAGCAAATCGGTGAGATCAAGCGAACATGTCAAGCAGAGCATCCTGTTCAAGTCGACGTGCTCGTACAGTTGTATAT
GATGCGTATTCGACCTGATCAGCCTTTGCCACACTACCTATCAACCGACAAAAATCCTCGTTGGATTCCTGCAAGTGACCTTACACCACTGGCTGCGGAT
GTACGGAGACTATTGCGAGAATCATTGGACGAACGCTTCTTCAGCTGATATTACAACGACAAGCAATTCCACAGGTGTCAATTTGTATTTGAAATGCAGT
TGAAACTCCACCCTAGCTTCAAACGAACGGAGAGGAGTCTCGATCGTGCAGTGATTTTGTCGTGCCGTCAGCATGGCAAAAGCGGGAGGGATGCTATGAC
CAGGAAGAATGATGTGAACGCTAAAATCCGCTGCAACTTATTGAACTTATTTAAGTCAGTAAGTGAACCCGCGGACGTCTCTGAATTTGAACCACCTCCA
CCTGTTGTGCAAGTCAGTCGACTGGAACCAGAATTTGCGCCGAGATCAGGCCGACCACCAACCTTTAGCCGGTAGGATCGACGCGCAGAAGAGGAACTTG
ATCGATGCCAGGATGATCCTGTTGACATTGCACGAAAGGAGGACTACACACCAAAGGAATCAGTACCGTATCACAAATGTCATATCCAGCAACGTGTTGT
ATCCGACACGTCAAATTAGCCAATAGAATAGAGCAAATGTCATACTTGAAAACAAATGTCATATCCGACACCTAATTGGTGGACAGCAAACCGGGACACT
TTAATTGGACGGAAATGCAAGCACCTTCAGACTTTGGTATCTCGATCTCACTACGCAATGGGCAAGGAAGACACAAGCCTTGCTGCAGATTGACCACGTC
GTCGAACGCTTCGACAACCTGGGACTGCTAGATAAGGAGGTAGGTGAAGGGCGGAGGACCAGGACTACGTTGACCGTATAGTTAACAGCATTGAATACGC
CGACGTTTAGTTTGATATCAACCTTGTGGAGCATTTGATGTCTCCCTACCCACGCAGGCGCACACATGCGCATGACTCGAGCATTATCTTGTAGGACTTC
GCTGGCCCCCCCCCCTTCCTGAATTTAGTGATGCCATTAGACCTACTTCGCCTTGGCCTTTTGTCCGGAAGATATGTCCCATTTAATTCCTGACTATTCC
TCAAATCCGTTGCAAATGTTATTATCATATATGACAGGATCATCATTCAGGCAAATATCCGTGAATTTGGGCTGGCTATATGACACTTGCGATACGGTAC
TTGAGTTTTGGCAAAGACTCGAGCACCAAGGCGACTACCGTATCATACCGAAAGCTGTGAGAGTGCTGTTCTCAATACCAGTATCTTCGTGCCAGATTGA
GCGTGATTTTGGTGTAAGCGGGCAGATGGTAAC