Description :
From Genome Similarity Track
Location :
Scaffold_136:7527- 10919
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_136-snap-gene-0.18Abnormal spindle-like microcephaly-associated protein homolog
Pytiw_DAOMBR242034maker-piw_contig_136-snap-gene-0.19Gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_136-snap-gene-0.20Conserved gene of unknown function

Sequence
3392 bases(100 bases per row)
ACTTTTTTCCTCCCCATCGTAGTGCGCTGCACGGTGAAGTTGCTCAGGATCGTCGTATGGCGTTCGCGTAAAGCTTCTCGCATCTTGCGCTCTCGTTTGG
CAAGAAAGATCTTGTGCAGACTCTGGATCTTTACTGCCGCAGCATTTAAGCGCTTCATGATCACGAACTTGTCCTGAGCAGCCATCGCAGCATTCTCGGT
TTCTTCTCGCTGCCGTCGCTCCTCCTTTAATCTGATGAGCTCACACTGAGCCACAAACCTCCGCCACGCGCACTGGATGACACAAGCCTTGAGATTTCGA
TTCGCTTCGACCAGCAGCGCCATAACTTGTCGCCATTTCTTCCTTCGGAAGTAACTCCGCGACGATCGTTGGATTTTGGTGGCACTTCCAATCTCCAATG
TGAACTGACGCCTCCAGTTCTCGCTCCAGCTCTGAAGTAGAAAGCGCACCAACTCTGAGTAATAGTCATGTTGGATAGCGTGGGCGAGCGAATTCTCAGC
AGCCTCAGCATTGTCGGTTCGATGGAAGGAAACACCTTCAAGAATGAGCATTTCAGCTGGCATGCTTGCGCTGCGCTGACGCACCACGTCGAGAGCCGAT
ATCACCAACAGCGGAGAGTTGAGTGCCGCCATCTTCTTTGCCAAGTCAAACCACAGCAAGTCGTCCTGATACCAGAGCTGGACGCGTAGGCTTTCGTTTT
TTCTTGACTTTTTGTAGATCTCGTGCGCGTTCTTCTCCGAGACTGTGACTGGCGCGAGTGCGATCATGACTTTGTACGCCTGAGTAAAGGATTCCCGCAT
GTGGTCCTGCATGCCAGGTACCTTGTCGAATTCCCGAGCAGCGAGCAAGTGCAACTGGTATGCACTCAGCCGGTGCGGCGGCTTTTCCACCAAGTACTGG
AAATACTGCGCACTCTCGCGATGCTTGCCGAGAGCTTTTGCTGTCACTGCCGACAGGAAAACCGCTTCGTTGATCTGCTTGAAATGCGTGTACCCTTCCA
CAAGGAGTGTGCACAGAGACAGTGCTCCTCGATACGCAGCGTACTCGATGTAAAGCTGAGCGAGCTTGAGAAGCAGCACGGGATTTTTCTTGTTGACTGG
GTACTCCATCGCGATGATGAAAGTGTTGTATGCCTCCTGTCAATATCCGCATCAAGTTTATCAAGATACTAGACCAGGCGGTTTGCTGAATGGCGAAAGA
AGGTTAATTACCTGGAGGAGTGACGACGAAAGCTCAATGAGAGTTCGTTTCCTTGGATCACCCGAAAGAGCTAAGATTCCCTCTTTGTGCAGCGCTGTGA
CATAGCTCTGCCAGTGCTGGTGCTGCGTGACTGCAAACTCACTCCATATCACTTCCGAATCTTCAATCTAGCACAACAAAATCCGCATTTACACATGAAC
GCGAGTCAAAGACAACCCAGCAATTGCCTTTCACTGCTATGTAAACCAAATCACTCACTCACCTCGATCGCCTTCTCAAATTCCAGGATTGCGTCGCTGT
ATCTGCCTTCATGTCGATCTCGAACTGCATTGTCGACAATCTGCTTGACTACTGGATCTTTAAAGACCACCGCGTCGCTGTCGAATGGCGCTTGCATCGT
CTGATCATGCGGTAGCACCGTGCATCTTGATTTTGCAGGTCATCGTTTCCAGTCGCTCATCCCTTGAAATCGGGAAGACTCCATTTCACTCGACCTGTAT
TTATAGAAATTGGTTTTCTCCTTTACGCCCAACCAACCAGGCCCACTCAAGATACAAACCATCCAGTCACTTCCCATTGAGTCACACATTGTCGTTGCGC
ACTTCCGTCGCAGAAACTCGGAGGTTCTCAAACTCACAAACGATTCGGAACATCGCGCTGCGTACCTCAATCAGCTCGACAGTCCCAATCCAGTTTTGGG
CCAACGTGGCTACATCGAGAAATTTGCGAAGCATCACAACCCGCTTTGAACTGGTTCCAGCTGATACTCCGCGACTCAAGTCTTCAAACTCAAGCTGTTG
GGGAGTTTTGGCGACTTCTTCTTCTACAGAGCAGAAGAGACTCCGACATGCTTTGTCTTTCTCGTGCTCGACGTGTGCAGGGCTCAGCAGCTCTTGGAAT
AGCTGAAGCTTCTCGACTGGGAAGTTTGGGTCTGTCAAGTATTTCAAAAACCTGTCGCTCACCTGGAAGTACTTGAAGAGCGCGAGTAAATCCGGGAATT
GCAGATCATAGCTGAGGTCGTTCATGGAGCGGCAGAAGAATAGCAGCTTCTTTGAGATCACGTCTCCCCAGTGCAATGGGCTCAACAAGTGTTCAATCTC
TCGCAGCTTTGGCTCAAATAGCACGCAGGTTAAGGCAATCGTGCCTTTGACAGACCCATTGAGAGAACCTGCGAGAGAAAGAAGTCAACAAAGCAAATAT
GTATCAGGAACAATTCGATAGAACACATATTGCGCTGTGGAAGCACGTACCCATTCCAAGTCGATGCACGAAGTCGGCAATGTCTGCGGCTGTGCATTGG
TCGTAGCAGGCGGCAAATTGCTTGAAATCGAGTGTTTGGGTGGCTGAAAATATTTCCCTGAAGCCCACTTCGTCAATCGCGCTCTTTTTCAGACATTGTT
GGAGGTTGTTGAATTCCTGTCGCGTTGAAGAGAATTGAGTACCGTCGTACAACATTGTCGGGTGCGTTCTTATGAAGGCTCACCTGGAGATCGAGGGTGC
CGTTGTGATCAGCATCGAACGCCACGAAAACTTGTTTCAGAATGCTCTCGCGGTTGTCTTTTTTCGCCAGGTTGCTGACTTTCGCTGCAATATCCAGCCA
TTCCTCAGCGTAATCCTGCACAGATTTGTCGAGTTCGCCAAGAACAAACAAGCTGCGAATGATGGAGCTGATTTCGATTCCATTCTGCTCCTGTGGGGAT
AGATTTCAACAGTTCAATTAAGCGAACGACCTTCACACACATAATGAAGTCACAAACCTGAAAGCTGGCGAAGAAGTCTTCGTTGAAAGACAAGTACACA
CGGAGGTACTTGATGGAGGGCGGAAACACGCCGAGTGGTCGAATAGTGGTTCCTATCGTAACTGTATCAAAAACAATATTGAGAATCATATTGCAAAGAT
AATCACCGGCAATCCGCTTGTATGCTGAAACCCTCAACCACAATTACCTTGGCAAGATGTCCATATTAAAGATAAGGTGCACCACACCAGCTCGTCGAGC
AAGTATTTCTCCACCGTAGACGCGAGATCCATGGCTTCTTCATCTGTAAATCACCAAAACTGTCAGCATGGACTGCGCTGTCACCAAATATGTACCATGT
GAATGCCGCACTTACCGCTGACTTCTTGTTTCAGACCAAAGTCGACAACGAGCCCCATTTCATCTGAAGCGGTCAGAGGATCTTGCAATATG