Description :
From Genome Similarity Track
Location :
Scaffold_5:752690- 758957
Transcript NameFunction/comments
Phypa_INRA-310PPTG_04574hypothetical protein
Phypa_INRA-310PPTG_04575hypothetical protein
Phypa_INRA-310PPTG_04576hypothetical protein
Phypa_INRA-310PPTG_04577hypothetical protein

Sequence
6267 bases(100 bases per row)
TCAACTTCCACCTCTTGGCCGTCTGCCTTGGACATTCGATTGTGTACTTGATCGTACAGTGACTCGAGTATTTCTGCATACTCGTGACGGACTGCCATCA
CAAGCGTCTTATCCTGTGTGTCAACATGGATAAACAACATAAGCTTGTGTTAGTACTGGATGTATCCCTCCTTTAAAAAATGATGACGATACCCCGACAG
ATTTCACCAAACCGGGGCTATTCTCGGCCAGCGCGTTGATGATGTCCACGAATCCGTGCTCACCAGCGATGTCCATGGCGCTTCGGCCATTGGTATCCAA
CGCGTTGGCGTCTGCACCGTGGGCGAGCAGCTTCTCCACGTGCTTGGTGAGACCGTACTCGACGGCGTTGAGCAGTGCCGTATCTCCGCACTGCACGAGC
ATCGCAAATAGCGTTAGAGTGTCAGCACGAGGAGAGGATGTATGCTTATGCTTGGATGATAGATACTATACCTCGTCGGGCTGGTCCACACAGGCGTTGT
GCGTTAACAGCATATCCAATACACTTGTGTCAATATCCCGGTCCGTGGATCGATCGCGCACTTGTCGACGCTTGGAGATGGCCATCTGAAGAAAGACGCA
ACAGCAATATAGACTTGCTATTAAATGGGTTTGAAAAGAGCGTGTGGACAGAGTTATCTGGCTTACTGCCACGGGTGACTGGACGTCAATGCACCGCGAA
CGCAGCAGCATCGTGGGTCTCATTTTCTGCAGACAGGTGCGCATGACATCGATCTGTAGTGCCGTCATACCCGTCTGAATATGTAGCACAGTACAGAGGA
AGTTAGACATTACTGGATGTGCGTTAATTTAATATGATATTATAGTCACCTGGTCCTGTAGCTCGATGTCGGCGCCGTGGTCAATGAGGAACTGGACAAC
AGCGCTGTGACCCTTCCACACGGCAACATGCAGTGCCGTGCACCGCTTGAAGGTCTTGTAACGTCGGACAAGTGCAGCCGTTAGTCGGGTGACAGAAATC
TGAAATCTTCAGTCGCTAACCTGGTGGTGGAGCTGTGCATTGAGCAGGTTTGGGTTGTCAGCGAGCAGCATCTGTAGCGTGACAACGTCACCGGAGTCGG
CCGCGTGCATCCATTGGTGTTCTGCGTCTGAGTCTGGCGTTCGTGACACTGGAAGTGCCGACATGGTGTTCCAGAGTGATACGTTCCGTTGTGCTGTTGC
TGCGAAAGTTCTCGAATGACCGAGTCTACTTGCTGGAAGTTGTTGAAATTATTTAGGGTATTCTGCTCATGCAGTTAAGAATAACTTATGTCGAGTGAAA
TCTGGAAGAAAATGGGCATTGCATTGGCAGAAACAAGGTTCACTATTCATGGCGATTTTTGTGTCTTGACTTCGGGCTTGCTGTATTCGAGAGGTTTTGG
ACGCTCTGGCAACTAGAACTCGCTCTTAAGTCGAAGAGGAACATAATATTCATACAAATAAGAGTTGCTTCTGCCGCTTGATGCGATCGTGTATGCATGG
AGCTAACGGCAACGATCACTCGCAGATTACCGGATCGCTGAGATTTTGCTGGATCCAGATAGGGGTGGTCAGCGGAGAAAAAAAAGCTTTTCTTAATAAA
AGTCTTAGAGGACTGTTATAAAGTAACTGTCGAAAATGGAGATGTGGTGAACGGCAATGTCTGCTGTCCAGGAGTCTTTCTAGAATACGAGCCGAACGCT
ATAGGGAGCATGCCGTGGTATTGGTGCAAGATTTAGATGCTTGAATCACCATCCAAAACGTAAGTACAGTTTTCCTCTATAATTTTGCCGACATGACAGA
GACCGAAACTAAATGTATAGATCTCGAAACATCCAACGGTACAACTGCCTCATGCAATCTAAATTCAACACAATCAAAGCTTTAAACCTTACTCATCTCA
ATACTGAACGAGCTTTGGATCAAACACCAATTCGGTGCGACCTCCAGAAATCTCATTGAATCGTAAAATACAAATTGTGTAATTTATATGTAAATTTCTT
AAGAATGTAATTTATGGAAAGCTTCAGTAAAGCATCATGCCCAAATTGTAACGAAACAACTAGAGGACCCGACTGGCTACATGGTCAACCGAGAAATGTT
TTTTCAATTCTACGTTAGATTTTGGCAATCTCTTGGCGAGAAATAGCCAGGAATCATTATCCAAAGTGCCGGGAATCTTTCCAAGCAACGGTGAGCTTGC
TCGACGTCTTCAGTTGGTTGACATATATGCTTGCGGTACCGTAAGCAACCAATTCTGAAATCTAGGAGAGACGCAGCTGAAAAACAGGGATTTTACAGAA
AATTTTAAAGGGATACAAAAAAAAACGACAGCATTTTCTCAAAATGATAAATGCTTGAAACTGCAGGCCGTTTTTGGCCGAATTCACCCGAAATCGCTTG
CGGAACAGAGTGTACAACAGAGCTTAATGGTGCTGCTTGGAAGCGCATGCAACATGCTGTCACGTTACATTGACACCAGGGCGTTCGAAGGCCAACTACT
ACCAATTCCTGCGTTGGTCAGATATTGATCATTGTTACAAGGTTGCAAGGATGTTATTCTTGCAGGATCTTTCTATTACTGTTTGCAGTTCTTTCCATTA
GGAAAATACAGTACAGGGGTGTCTCTTGCTGCTGCTTGGCATCCGTCGCCTCATTCGAAAACTTTCGCAGCAACAGCACAACGGAACGTATCACTCTGGA
ACACCATGTCGGCACTTCCATTGTCACGAACGCCAGACTCAGACGCAGAACACCAATGGATGCACGCGGCCGACTCCGGTGACGTTGTCACGCTACAGAT
GCTGCTCGCTGACAACCCAAACCTGCTCAATGCACAGGAGCGAGGGTCAAATCTACAGGAGAAATTTGCATATGTACAGACGAATGGCTAGAATTACTGA
GACCGTGTGAAATATACAGAATTGAGGACGTGCTTACAGACGGATGAAGTAGTTTTACAAAGCTGTCGGTTGAAAGCACAGACACAACTGTCATGATTGG
TGGTGACTTCCACGCGCTATTCCGTCTGCAAGCGGATTGGCCAGCTGAAATAGTCTCGTGCTCAAATTCTAAGTTAGTCGTTTAGTCCGGATATAGGCGT
TCATTCACCAAACCATAACAGCCCCACAGAGACACCTTCATCTCAAGAATCAGCATGCCTAACTACACTTGGAAGTTCATTCGCTCCTGCTCGACTGAGG
TAGACATGGAGGATTTTATCGATATACAGAAGAGAAGGTTGAAAGTTAAGAATGAACTCGAGAGATGCCAGGTGTGCTCGCCGAATGGGAATCAACACCA
GATGCGCTATATAATCTACAAGTGCAATTCGACTTCGTGTTCGGAGAGTGCAAGTAGCCTCCAGAGTTGCAACTGGTTTGTCAAAGTGCTGTTTTGCCAA
GAAACCCTCAAAAGCAATATTTTTCAGAGTGGAGTCCACTTGAGCACTATATCATCACCCAAGACGTTTGGAATTAGTCTTGGTATGCAAAGATTTATTC
GAGAGCGAGATTCAGCGGGTGAAAAGCCATCTCGCGTAATGAACGAGATGGTGCTTCACTTCAAACTGGAGTCAGCAGATCCGAGAGAATTGCTACCTCG
TGTTCAAACGCGAGTTTGGAATCACCGTAAAAACATCCTGAACGGCAACGACTATGTTGATGAAATGGAGGCTCTAATTCAGAAAAATCGGTACTCAAGT
GGCCTTGGCGACAACGTAGCCTTTGCTTTCGGGTATGCTGTAGGCTATATCGGCGAACCCAAATTGGGAGAGGGATCCGACGAAATCCCGCTAGTGGTCG
GGTTTGCGACAAAAACGTCTATTCGGCGACTTCAATATGCCAATAGCTACATGACCCATCTTGATGCAACTTTTAAACTCAACACTAGAGGTTTCCCGGT
TATCGCTGTTGGAGTATCGGAGTTGTGGCGGCAATTTCATTTAGTATGCATGTTTCTAGTGTCCGACTTGAAGCAACCTCAGTGGGAACATGCCATCTGC
TCAATGTTAAATATGTACGTCACCGTTACGGGTGAACAAGTTCACATTAGCTACGTGATGATGGATGCAGATGCTGCTCAACGAAGTGCCTTCGAATCAA
TTGCCGCTCAGTGTCTAGATGTGGAGAGTCAACCAAAGTACATGATGTGTTTTTTCCACGTTATGAAAAACGTGAAAAAACGCATCACCTATCTTAGTGA
ATCCAAAAACCGAATAGTTTTTCGCCACATTTATCGCATTCACTATGCTCGGGATGGAGTCGAAAAGAAGCAGTGTATCAAAGAGGCGATAGCTGATTGG
AATAAAGATCGCGATTTGAAGGAATTCAGTAGTTACTTTCTCAAGCAGTGGCTCACCGGTAGATTTAACCTCTGGCAGTGCGTGGAGAGTCCCATGGCAT
GGCGAAGGCGAACAACCCCATTGAAAACTTTAATGGACAATTCAAACAGCAGCACACGCAAAGGAGACTTCTGCGGCTAAACACTCAGTTCGAAAAGCTT
CTTGAGTGTTGCTCTTTAAAATCCATTTTAAGCATCACGTTCGAGACTACAACGCGTGCATCAGTGGAGACCTTACGTGCCTATCGTAAATTATCGGCTC
AGAATGCGTTTAGTATCACCCTTGTCCCAGAAACAACGATCAACGTTCACAGCGGTCGCTTGTATAACGTTTATCAGCGGTACACCAAAACTACACTGTC
AAATAAGCCCTCAGAAGCGGAGGAGCAGTCAGCAGTTGAATACGATTTTGAAGCAGAGTCGCAACCCGCATTTGGCTGGTTCGTTCACCCCGAATTTCGA
CAGTGTAGCTGTAGAACGTGGTTTAAGCTGGGTGCGTGTGTGCATCTAATCGAAGTGCTGAACCTGCTCGGCAAAGCTACCGAAGGATCTGTAGCCAAAC
GACAAGTCTTTGAGGACCGGCGTATTAAAAAGAAACGCGGCCGTCCGGCTCAAGCTGGCTCAGCTCTTAGTCTTGAGTAATTTGTTTCAGCTATTCAACA
CTTTTCGTTTATATTAAAACACTGCATTATTCTTTTCTGAACCATTTCTCGTTACCTATTGCTAAATCCGTAGGTATCAGTGATATGATATGGATGTGAT
CGTGCTTCCGAGCGGCACAAACACGATTTACAAATAGAACTATTCAGACATACAACACTAAAAGGCTTGCTCGGCAACCTTACTTAATCTACAACCTCTG
ACTCTCGAAACCACTTTTGTCGTCCTGAGCGACGATATGCTATGCATAATGGCATCCATAGCAACACTATAGCCGATGGGCACATGTAACGATGTGGATG
TATAAAGAAGATAGTACTGCACTTGATCCAAAGAGCGTAGGATCTCGTGAAAACAGGCTACAATAATGAAGGGTTATCAACCCTGTGTTTGTATGGGTCT
CGGTCCCGGTCTTCTTATCGATAAACGGACGCAAAGACCTAACGCCGATAACTTTGTTTCGGAATTTAACCAATCAGAGGGTTAGTATAAAACCAATATG
GAGTTCGCTTCTAAAGAATCAGCTGCACGAGAAGAACAAGAGGCTCGCAGTCTTACGACGGCACTGGCGCTGGCACTGAAAGCAAGAAGCTCCATGGACA
CCAACAGGAGTACTGTACGAGATCATGACCGTGCCAGCTGAAAATACGGTGGGAGACCATGCTGATGGCGGACGATAAGGCTTGGGGGTATCTGGAGCTG
GACACCGCTACCAAGCATGACACAAACCAACAGCTGAAGGATGAAGACTTACTTGAGGCTCTGTGGAGGAGCTGGGGCGATGAACTGGGCTTCATGAACA
AGACACCTGTGTATCTGGATAATTTGGACGCTCTGAAGAAGCACCAGATCCATGCTGTTCACGCTCGCTCTCTACTTGTTCTCGACTTTGGCGATGAGCT
TCACTCCTGAAGCGATTGGCTTTGGTTCGCTGTTTCTCACGCTCCTGATGCCGACCAAAAATTTGCCTTCCTGAGCAATGACCAGATCGTACCTCATGAG
GATCACGTCGGTTAAAGTGTAAGAGAAATGATGATATGGAAATCATTGAGAGTGCGATTGTTGGTTGGATGAATAAGGGGAAGAACAACGAGTTGTGTAT
GGCTTACAATTTTTCCTTTCCTTCTATCTCTGAGGTCCTACTTGTAGATTTGGATTGGTGAAAGTGTTGGTGATCTCTTCACGAATGGTTTCGATGTTCT
TCGACAACCAGTTTAGAGACTTGCTCTTGCCTCTTCGATAGTCATCTATAGCTTGGACAGCCATTTC