Description :
From Genome Similarity Track
Location :
Scaffold_167:75259- 78297
Sequence
3038 bases(100 bases per row)
ACCACACGGACAAGACCCAGATCGTGAGGAAGAAGCTGAGAGCGCCAGGCTTGGACGACGAAGATCCCAGACCGTCGGCGCTCGACTGGTCTGAGGCTGA
CCTGGATCGTCAGTATCACTTGAAGGAACTGCGAGACTTCTTGCGTCAAGATCCTGTCATGGTGATCGTGCGGCCAGAGCAGATCGACGACCCGAAGGGC
CCGATTTCAGCCCCCCGAGTGACGGATAACAAGCTGATGGCGGTGAAGAACCTGCTCGGGCTGTTGAAGGAAGCCGGCTGTGTGGCTGGCGCCTTTGAAG
CGAACGATCTTTTCGATCAAGACCTCGATGTGATCCAGACAGCGATCCAGACATTGGTCGACAAGTTGAGACCTTTGGTCGACGTGATCGCGGATAGTCC
GGGCCCGAAGGTGCCAGATCCAGTGTCACCGGCTCCAGTGTCATCGCCGCGAGTGGAGTCCACTGGGTACCGATCGTCGTCACCTTATGTCTCTGCAGCG
GAACATGTCTCGGATACGTCGTCTGAACCCCAACGGATATCCCTCAGCCCTTCAGGATCTGCGATGTTGGACGCGCGATCACGGAGTCAACATCAGGAAC
GCATGCGGTCAGGACCTCGGAAGCAGAACCCCAAGTCGACCGATCGGACCACCAGTGCCACCGGATCGGATGAGTCGAATGGCAGACTGGAGTCTTACTT
TCAGGCTGCGATGACTCGATTTCTGAAGGAACAACAGGTCACGGTGGTAACACCTACTCCAGTGGTCGACGACAACGTTGGATCGCGGGACGTGGAGATG
GAATCAGCCGGATCACCGGATCAAGATTTCTCCCAGTGGGAATACGATCCGGACGATATTGATAATCAAATTGCATTACACTTTTAATAGCGCGAGTTGC
CTGGCTAGTTAAGGTGTTGCATCCGGACGATATTGATCTACCGAGTTCGGTCCCTGCTGCGGTGGCAACCGCTGCCTCGGGATCCGCTGGGTCCTCCTTG
ATCCAACGTGTGCGAATCTCCGCGATGTCCGATCTTAAGGATTTCAGTGGCAAGGATCAGGACGAAGACCGCGCCCGTTCGTGGATCAGCAAGGTGAAAT
CAGCGCTCCTGCGAGATCAGGCTACGGACGAAGATAAGTGATTGACCTTCGCTGATCTACTGACGGGCCCGGCGAAGAACTGGTACCACCAGCTGGGCCG
ATCGACGCGGAACAAGTGGAGCGATCTACTCCGGAGTTTCCAGATCCAGTATTGTGGCCTGGGAGTATCGGTCGCTTGGCAGTATTATCATTCTCGCAAG
AGATCAGATGAATCGCCGTTGGAGTACCTCTATCGACTGAATGTGGTGGCTCTGCGTGCAAGATTGAAGATCAAGGACGGAGATTCCAAGGCCCGCCGAG
AACATGTCGAACACTTTATCGAGACGCTGGCCGATCCGGAACTGGCCGATCAGCTCACCCTACTCCGGCTTGCGGACGCGGAAGATCTGGAGGAAGTCCT
GCGCGCTCGAGAGCGCGCGAAAAGTAGACAGAAGCGATCCGCCTTTGGATCGAAGTATCGTCAGAAAGTTCCGACCTCAGCACCAGCTGCTGCAACCAAG
CGGGCAGTGCGTGCAGTACAGATCGCGAGCCAGGGGTCTGGATCAAACACGGGATCAGACGGATCGGACTCGGAGGGTGATCTACGTCGCGTTTACCTAG
TGTCGAGCGAGGACGAGTTCCGCAACGCTGGGGGCGACGCGACGAAGCCGGATCGAAGCAACCAGGCGCAGATCAACCATGACCCACCTCGATCGGATCC
ACGATCGCGATCTTCACCTGACGGATCGGAGCGATCAAACCGCTGCTCACATTGTCGATCGCGGAAACACACCCATCTCGATTGCTGGAGACGTTTGACG
TGGCAAGCGAGGTCATCCAGCGGATCGTTGCCTGTTCGTGTGCCGTGGATGTGGTGAACTGCACGAGATGGGCAAGTGTCCGATGGAGGAATTCTACAAC
CAGATCCGTCAATGGTTCAACCCGGCGAAGCACGCTGGCATGCTGTCCGCGATCGCCGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTGGAATCCGGT
ACGAGCCGAGCGTTCTAGGTACTGCATCTATGCATTCGTGAACAAGAACACGGTAGATCGAGTAAGTGGACGGACTGATCTACGCGGAAAAACATGTGAT
CTACATGCGAAATTTGCCGCCAAGGTCTTAAGTCTACATCGATCGGACGACTTCAGCCGTTCCGACGCCGAAGTGCCCTTGGATCTCCAGTCTGGAGAAA
CATGGGGCTATTGGAAGCAGCGCAGACCGGAGGAATGGTTCAAGCCAGCTGATGGAGAAGTGACGACCGAGATCCCGGAGCATGATCGCGATCGAAGTCT
GCCTCGCGTCAGCGAACACCGCAGATCTGGCGATGTGGTGCCCGATCTCCTCCCTGGGGAGTCCAGAGGGTACTGGAAACATCATTCGCCAGGTAAGTGG
TTCCGTCAGGCCAAGATCACTGGCAAGATCAACAATGAGAAGTCGATCTTACTCTTAGACACCGGCGCCGATGTGTCCATCGTGGACACCGCCTTTGCTC
ATAAGGTGGGGTGCTCTGTCGACACGAGTCAGAGCCAGGAATGTGTGGGGATTGGCGAAAGCGTGTACATGACGGAAGGAAGGACCAGGATCAAGGTTAC
GCTGGCGGGATCGCTGGTGTATTTCTTCGATATCTTGGTTGGCGATCTATCAGGACAAGAGGCGATCCTGGGTATGGACTTTATGGTTCCAGCGGGGATC
CGCCTCGTTCTTGCGGACGGCTCTATCTGTCTCCCCGACGAAGTCAAGATCCAGCTTAGCGGACGGCGTCAGCTGTACAACGACAATGTCAGACACGTGT
GTGTAGATCAGAGAATACAGATCGCGATCGGGGATTCGATCGAGCTTCCGCTACGAATGAAGGTGACCGATCGAGAAAAGCTATGGGTCACCCGTGGAGA
TCGTTGGGTGCCGACCGTGGTCCGAGGACCCGGCAGGA