Description :
From Genome Similarity Track
Location :
Scaffold_837:7520- 13899
Transcript NameFunction/comments
g10130.t1hypothetical protein
g10131.t1hypothetical protein

Sequence
6379 bases(100 bases per row)
CCGTCGCGAGACGAGGACGAGCCTATGGAGGCCAACGTTGTCTCCAACAACCTCGACGAGGTCCAAAGCCAGCAACTGGCCGCGATGGAAGAGGCGCCCC
GCGCCCAGCGTCCGATAGCACGGCCTCTGCTCCACTCGAGCCGCCGTGACTACGGCTTTGAGCCACGCGACCCCAACGAAGTGGCTCGCCTAGCGGCGTC
GCAACTGTTGAATGACTATGTCATCGGACCCGCGGCCCATTCCAACGAAGAGGTCGCTCAGCGAGAAGACCTCCGCCAGAGGTTGCTGACGCCTCAGCTT
ACCACTCAACGCGAGTACCGTGAGCGCCTGCAGCTCCAAGCCCGGGGGGCGTCCGTGCCGCAAATGCGGACGTATCCAGTGGTCCTACTGGCTGGCGAAC
GCCAGGAGCAGGATGTCGCTCAATTCGAGCTCTGGGTGGAAGGGGCTCGTAAGCTCTCTTCCATTGTCGCGATGCAAGCTAGCTTCAAGAAGGACGACGT
CCTGTTAGAGCGTCGGCTCCGGTTCGCGTTCGCGAAGTTAAAGGCGAAACGCCAACTTCCTTCGGGCTTTCAGCCCCGCCCTGCGCGGGCTCCTCAACAT
GCTCCTCCGAGCTCTGCAGACCTTCCACAAGGTGGATCGTCGGCTGCAGCAGCCCAGGGTCAAAGCTTGAGCTCAGCTGTTGACCCCCTCGCTCCCCGAC
CTACTGCCGGGAAGCGGGTGGCGACCGACGCGCCGGTCGCGAGCCCCCAGGGCGCCGTCGATCGTTTCGATCAAAAGCATCCACGACGTCAGGACAGTCT
TGCCGGAGGGGTACCTCAAACTCCCATGAGTTCTGCGAGTGGGGGTACCCTCGCCACTTCACCAGATACTGGTATTGATTTTGGCGGCGACGCCGAGCCA
CAATCCGTTCCACATGGAAGTAGCGATTGCCCTGCTCATCGAGCAACGCCGGTGGCGGACGCTGAGATGCACTGGGTGCATCGTTCGGAGCTTGAGGACG
CTTGGAACGCGATGGGATCGCTGCGCCGGGAGGTCGTACGTCTCCGTGAGACTCTCCATCAGGCCGAGAACGCCTATGATCGTTCATGGCATGAGATTGA
TCAGCTCCGGGAGCGCGTCGACTGGTTCGAGGCCCCAGCTGCGCTGGCGAACCGGGTCTCCGACCTTGAGCGAGATCTGGCGAGGCTGGAGGGTCAAGTC
GACCTTCTGCTGCGACTTCAGCAGGGTTCTGTGGCTGTGCCACCTGTGCACGTCCCAGTGCCAGCGCCTCCGCGCTCACCCGCGCCGGGTCCCGGTACGG
CTTGAGCAAGCCCACATAAAACACCGGATGGGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCTTGGCCACGACTTTGAAAGGTCCG
ATGAAGCGTGGGCGCAGCTTCGTCTTGAAGACCGCAGAAACTGCATGTGTAGGTAGGTTTTTTGCGTTTAATAAAACCAAGTCTCCGACTGCGTAACTTT
CAATGTTACCTCTGCCCCTGGCATCTGCGTTTTCCTTTTGTTGGTTTTGGCTCTCAGCCATAGCGTCACGTACGTGTCGAAGGACACTCAGACGCGTTGA
CAGAAACTCGTCAACCTGTTTACGAACAGTGAGAGGGCTGACATCAGCAAGCCGACCGACTATCTCTCCCCCACCAAGCCCGGAACCACGGAGTGGTAGC
GTCAACGGGACGCGAGGGTGGGTGAGGCCATTCACGTAGAATGGGGTAAAGCCTGTGGAGGCATGAACAGCATTATTCAATGCGAACTCCACGAGTGGAA
GCATGGTGCTCCAACGCTTGGGCGTTTCGGCGCAAACGCTGCGGAGGACGTCCTCCACGACGCGATTAACGCGCTCGGTCTGACCATCGGTCTGTGGATG
ATCCGTTGTGGACATGTCCAATCGGGTGCCCAGCACCTTGAAGACGGACGACCAGAACTTACCCGTGAAACGGGGGTCTCTATCCGAGACGATCGACTCG
GGCAGCCCGTGCTGGCGGAAAACCCGGTCGATAAACAGCTTGGCTGTACCTTTACCATCAATGATGTCCGGCACCGCCGCTAGATGAGCCATCTTGCTCA
AACGGTCGACAAAGACCACGATGCCCGTGTTGCCATCCAAGTCCTTCGGAAGGCCGAACACAAAGTCCATACTCATGGACTCCCAACACCCAGAGGGTAC
AGGCAAGCTTGCCAGCGGCGCGGCCGCATGCGGGGAGGGCTTCACCCGCTGACACGTCTCACACGTGCGCACATACGTGCTCGTCCACTTGTAAAGCTTG
GGCCACCAATACGAGAGGCTCACAGAGCCATAGGTCTTTTCACGACCAAGGTGGCCACTAAGCGCAGTATCGTGTGCCTCATAGAGGATACGATATTTCA
GATCCTCATCGTGAGGGACCACAATACGTGGAGTATCCTCCGGATCGGTGCTGTAATACAGCAGGCCATCATCGAGCGAGTATCGATGCAGCCTCGCGCG
TAAGCGCGCCGACAGCTTACAGTCCGAGTCTCCAAACTCCTTGCTCCCAAGAGCACGTAGCAGAGCGACACACATGTCGTCACGCGCATACACAGCGCGG
ATCAAGTCCGTCACGGACGACGTCACAGTCGTGACATGTGATAACTCATAGTCGTGTCTGCGGGACAGCGCGTCCGCTAACCCGTTCTGCCTGCCAGGCT
TGTACTTCACCTCGAAGTTGTACTCCGCAAAGAAGGAGAGCCAGCGGGCCATTCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGCATG
ATCAGTAAAGATGACAAATGGCTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGATAG
TTCTTCTCTGCAGCTTTAAGCTGGCGAGACTCAAACGCAATTACGCGTTCACGCCCTTCGGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAAGTCCG
ATGCGTCACAGACGACACTAAACGGACGATCAGGGTCTGGCAACGCTAGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACTTGATG
CTCGGTGTCCCAGGCCCACTCCACATCCTTCTTAAGGAGATTGGACAATTGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAATAGTTGGCG
AGGCCAAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGAGGGATCCGCTCGAAGGCCGCGCTTCCCGA
TGAAGCACCCTAAGAAGGGGATCTCTTCAGCACCGAAGATGCATTTGGATGCGTTAGCGTACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAA
ATGGTCTATGTGGTTGTCCACATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGTCCGATGGGGCCGG
AAGAGCTGCGTCACTAGACGATTGAACGTCGCGGGCGCGTTGGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACCG
CTGTCAGCGGAATGTCGCTCGCACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCTGTGCATCCAACCATGTTGTTCTGGAG
AACATCCTTCCTAGGAATAGGCGTCTGCGCCGGGATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACTATGCGCCACTTGCCGTTTGACTTTCTGACA
CAGAATGTCGGCGTCGAGTGCGGAGACTTGCTCTCGCGCACCATGCCCTCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTTG
GCAAGGGCCACTGCCTTGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACACACGCCTCGATCTGGAGGTAGGTCAGAAGGCGGATCGTT
GGAAACGACATCTTGGTATTTCTTAACCAAGGGATAGTACGGATCTGAAGGATTCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGCCTGCTTCGTG
TCCTCCAGGACTGTTTCGTCCATAAGGGACGACGAGTTTAACTCATCTTCAGGTCGTATAATAGCGACCTCGGCTAATTCGCCCACCTTTAAGGCCTCGC
CGAACTCGGCAATTGACATTTCGTCCAGCTCTAGCAGAACATCTGCGGCGGGAACAGCCTCAAGGCTGACGTCGCCAGCGACCTCGCCGGTCACTCAATT
AACGAGTGTATATAGCTGTTCGCTATCCACCACCCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTCTCGCAGCTGCCACACGGCGTCGCTGCCGT
CTCCTCGCGGAGACCATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCACTTCTTGTTGCTTCATCGGAGCGTCGACGT
CAAACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCCACTCCACACGCATCGTTAGGGCTGGGCCCAGGATGCCT
CGGCTCGTGGCCGACCGCGCCATCGTTGGCACGCAGCGATTCTCCGCCATCGCGGCGCTCACCGCTCAGCGGATAACGTGCCGCTCCACGCGCATCATCA
GGGCTATGCCCACGATGCCTCGGCTTTCTACCGACCATGCCATCAACGGCCTGCAGCGATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTG
CCGCTCCACGTACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAATCAACTCCGACACGCCGATGTCCAGCACGTTCACCGTCTCGGTTCA
GTGCTCTCGCCAATAGCGGTTTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGAC
CTCCAATCAATGCATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGGATGAGATCATATCTCGAATCCAGGTCAAGGACCAGACAGCGTTCAACGCTAT
CGAAGTCCAGAAACTTCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACGCGGGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGC
TACCAGCGCCTCGGCATACTGCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCTGAATCGATCAATATCGTCCACGGCTTATCA
AAGCCCTTCACGGTCGCTTCAACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTC
CTTGCTGAGGCTCAACAGAACTTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGAGCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAA
GCAGGGCTTCGGCTCGCCGGAGTCTGGCGCTGCTTACGCAGCGGGCAACCTGGTCGCAGGTGCTGGGTGCTCCCACACACGAAGCACCGGCGGATGCCGA
TGCGCTGCTCGGCAGCAAGAAGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGATCCATCGGCTCGGGTCCACCCGAGGAGCCGGCGGCTCCGGATGAGTT
TGTCTGCGACGTTCCCCACCCGGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCAACGCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGG
AATACTTCCGTTCTGGCCACGCCAGTGCGAAGGCCTTCCATGAAGATGGTCACCGTGACCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGAG
TTCGTAACTCTTGGACGAAGTCCACCAACTCCTTCTTTCCTTGGCGGGTAGCCAGGAAGCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACAC
TCGCGACAGCTGAAGCTTCAGCTGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTGCCACACGTTAGGGCCCACTCCCGGGCCCGGCCACCAAGCTTG
GACACGGCCAGCGCCACGCGTTGTTGCTCCGTCTGGAGTATGGCGGACGCCATGGCCATCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCT
TGCCCTCAAAGGTCTTCACGCTCACCATGAGCGGCTTAGCTCGTGGAGCTCCATCCGATGCCGGCTTGGGCGTTGTAGACGCTGTCACAGCCGTCATCTT
CTGTTGTAGATGTTCCAACAGAGCATTCTCATAACTCGAGAACGCCTCCAGACGCGCATTAATCGCGTCGGGGCCTTGC