Description :
From Genome Similarity Track
Location :
Scaffold_195:7520- 9026
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_195-snap-gene-0.18N-acetylated-alpha-linked acidic dipeptidase

Sequence
1506 bases(100 bases per row)
TCCAGCAATAATAACCTTTGCGGAGAGCGTGATGTCGCCCATGCGCACGAGCACGATGTTGCCCTCGACGCTCACGTTGGCCTTCTTCAGGGCCGCGTAG
TCCTTTGACGTCCCGTAGTTTGCAAACACGAGCTTCCCTGTCGCGCTGCCGTTCTTGGAGTAAAAGTGGAAGGGAGGGAGCTAGCACAGAGTACACATTG
AAGGATGAGTGGAGAGATTCCTAGTCACAGGCTCACATATGTTGAGATTGTCTCTAGGACTCACCGGCATTCGCGAGCTCTTCTTGGTCTTAAAGTTAGA
CATGAGGTCGTATGTCGTTGTGGCGTTCTTCTTGTCCTTGATCTCGATACGGAGCGTCTCGGGCTCGTTCACGAGTATCTCGAATTCGTCGATCTTGATA
AAGTCCTCTTCGATGCCGAAGTCGATTGCCTTGGTGCGGATGTACTTGGCCATCTCATAGTCGCCCGTGCTGCCCGTGTGGCGATTGCCCTGCGTTTTCA
CAGCCATACCGCAAGTTAATGCACAACTCAATAGGATAACGTGCCACGATTTAATCCATCTGTTCCTACCGAGGTATACTGCTCCAAGTTCTCTTTTGCT
CCCTTGGCCGTCGTCGCCGACATGAAGCGCTGCTGCGTAGGCGGTAACGCACTATAGAAAACACCACAATCCAGTACAACGTCAATATGCCTCAGAGCCA
AGGTGACCAGACAGTTCCTCTCGATATCTCTCCACTCACCTGAAGGACTCGTGCTCCGAGAGGTACTTCATGAAGAGCACGCAGAGCATGACGGACATGA
AGAGACCAAGCACGGTGGCCATGCCGACGTGCTTGCGGCGCGTAATCTCTTCATCGGTGAGGTCCTCATCGATCTGCCCCACACGCGGAGAGTCGATGTA
CAGGTTCTTGGCGCCGAGTAGGTGGTTCCCCGACTCATCCACGTCTTCGTCGTCCACGTCGTCGCCGCTTGGTCGACTCAGATCGAGCTTCAAGTTGCGC
TTCTGCTGCAGCGAGTCGCTGTTGATGATGCTCACCTTGTCTTCGTTCCTGCTCACGCCCATGACTGCCCAGTTCGCTTTCGTCTCGACCTGCGTGATTG
AGCTATGAGCCAGAGCGCCAACTTGTGCGAAGCAAGGAGAGAAGGTTGGAAGCCAGGGCCATTCCTGCTGTCGCAATGAAATGAAAAGCTATTTGCGGTT
GCTCGTGTGGGCATGGGATGCCGCTCATGCCACGGAGGGGATTCATATCCAACAGAGGAATAGCGGCAGGCAGGCGTATATTAAGATCTACCTGTCATCG
CCAGGGCGGTTGGTGGTGAGGGACTATAATTGCCAGCCAATCCGCTCGTGCAGTCTGGACTTTGAGCCAGTTGTATCAGTTGTGAAAGCGCGGATCCGTT
TCTTTCTTCTGCTTCTTCTTTTAGCTACTCGCCTTCTTCGCAGGTCGCATGGAAACAAGAATCTTATATCCAGACTTCCTGCAACACATCACACAAAGGC
GCATAA