Description :
From Genome Similarity Track
Location :
Scaffold_3629:752- 2423
Sequence
1671 bases(100 bases per row)
AGAAGCGCCAACATGGTCGATGGTTTGAGCCTACCAAGAGTGAGGTCACTGCGGATCCCCCTAAGATCTGTCAGGTCACTGGATCCCGTGGATCTGAGGA
TGTTGGATCCATGGATCTGCTAACAGAGAGAGTCCGCGTGAGTACTGGGAGAGTAACATGCCCGGGGAAGGTGGTTTCAGTACAGCCCGAGGTGAGGGGG
CAGAGATTCAAACATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTGGATACCGCCTTTGCTCGTAAGGTTGGGTGCCAAGTGG
ATGGGAGTCGGATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAACGGGAGAACGCGGATCAAGATCACGCTGGCAGGTTGTTTAGTGTA
TTGGTTTGACATTTGGGTCGGGGATCTCGCTGGTCAAGACGCCATCCTTGGGATGGATTTCATGGTGCCGGCCGGAGTGAGGTTGGATCTGGCGGATGGG
ACACTTTGTTTCCCTGACGAGATGCGGATCCAGCTCAGCGGACGGCGGCCGTTGTACGGAGCGAAGATGAGGATCATAAGGGCGGATAAAACGACCTGGA
TCGAGCCCGGAGAAACCTGGGAACTGCCAGATCGGTTGAAGTGGGTGGAACATGAGAAACGGTGGGTCACTCGGGGCGAGAAGTGGGTGCCTACCGTAAT
CCAAGGACCAGGTCGATCACAATACCCCCAGGTCACGAACGTCAGCGACAAGAGACTATTACTGGACCATTATGAAGAGATCGGACGATGGTTGGCGAAG
GACGGTATCCCTAGGCGACCTGGATACGTGTCAGTGGGATCCAGCCGTTACAGAAAATGGCAGAATCTGGCGTACGAGGCGACTACCGAAATCGAATCTT
TCGGAGAGGTGAAGCTCCCAGCGGAGCCAACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGA
GATCCAAGCAATGGAAGTTGGATCCAGGACGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAA
GCCGAGCAGCCGGATCCCGCTGATCCACAAGTGGATCCAAGTGTGTTGAAATTTGCGTACTACCCGGGATTGCTTGCCCCCATCAAGGTTATCTCCGATC
ACTTATCCCACAGTCACGGGCCGTGAGGCCCGGAGCGGTTTTAGTTTGCAAATTGTGCAGTCGAATCTTCAGGGTTGGGCCCCCGGATAGTACTGTAGCT
TGAGGTGCGATATCCTTTTGCCAAAAAGGCGGCCGTTAATTGCAAAGGCTGGGTATTGATAGGCTATTACAGCCCCCATCCCATCTGTCGGTTAAAAGAG
GCCAGTTACGGTACCCCTCCTGACCAACTGCACGCACGCAATGTGCGTGCCCATCAATAACCATTACGGACCCGGCTCAACTGGTTCGCTGTCGGGTTTT
GCGGTCAATGGACCAGGTGCCAAATGTGCTCTCGCGCAGAGTGGGGCGGTGGGGATAAAGCCCCAAGACCCCAGAGGGCTCTAGAGCTTAATTCCCCATA
GCACGGCTACCTACTTGCAGGATAAAATCCCGCAAGTTATAAGCTACCCCCTAAGCAGCCCCCAGGGAACC