Description :
From Genome Similarity Track
Location :
contig_24:751976- 753223
Transcript NameFunction/comments
g5812.t1hypothetical protein

Sequence
1247 bases(100 bases per row)
GGCATAGTCGTTTCCGTGAAATAGAACCGAGGAATTCGTAGACTATTGCTTAGGGCCTCCAGCAGTGCATTTGCCGACATTCCGGTCGATGAGCTGTTAC
TGCTGTTGCTCGCACTCGCAGAATTATCCGGTAAAGTAATTCCGACGCTACTCAAGCCTTCTTCGAGCGACGACGCATAATCTGTAGTATTGAAGAGGCT
CCAAGCGGAGCCATGATCTGGAGCAGAGCTGTTCGCGTCACTGGTCGCCCACCCTGCTGGGATGTCTAGGTCGGGTTCAAACCTCTTCAGCGCCACGAAC
AATAGAATGCAAAGCAACGGGTTTAGCACTTCGCTCCACGTCGCGAACGGGTGACGTCTCTTGATCGTCCAGTTTTTCGCCACCAGCGCTCGGACCACTG
GCCAGGAGCGTCGAGTCTTCATCCGTTGCCACCCGTAGCTCAATCAATGAACCACCTCGGTGAAACCTAATGTTTTTTTGTAAAACACATTGAAACGGAA
AAACTCCTCCTATTCCTAGTCAAGTGGACGCCAAACTAGCACTGGTCCTGTCGTTATAGGGCCAAGAGGGTCCTCACTTTGCTTCGTCCTCTTTTGCCTC
GCGCTTGGCCTTCGCCGCTGCGATCTGCATGAATTACAATACCAATGATTGCATAGTTTTAGCGATTATTATCCTGGCTGTAGTTATCAGGTTCTTTTGG
TGGTCTTGCCTTGGCTGCCGTGGCCTCTTTCCGACTGCCAAACTTGCGATTCTTGCCGTGGATGCGGCTCGCCTGTCCGCTGGGTGGTGGCCGCGATGGC
CTGCGCCGCCGTCTCCTCGCACGCCTGCTTGAGCTTCAACGCCACGCGCTTGTGCTGGATGTCCGCCATCGTCTTGGAAAGTAACCCAAGGTTACGTATC
GACTTCCACCGTAACTTTACGGATTACGCGGGTTACGGTAACCCGCGTAATCCGTAAAACATTGCAACTATTGGCGAGCGGCGATCATGATGCCCCGAAG
CAGCGTTTCCTCCGTCAAGAAAACGGCGTCGACCACGGAAGGTGCGTGGCCATGACAATAGATTGATTGCAAAATGGTTATGATGCTGATTGCAGTGATT
CACTCTGTGGTGACCTTGCAGCGCCAATATGGAAAGCGTATCTGGCCATCCGGACGGGCAATGCTAGTGGAGCTCTCAATGCCGGCAACGCAGTTAATTA
TACAAGAAGAGGCAGCAATAGTGACAATGTTCGCGGTCGGAAGAGAA