Description :
From Genome Similarity Track
Location :
contig_24:751972- 753215
Transcript NameFunction/comments
g5532.t1hypothetical protein

Sequence
1243 bases(100 bases per row)
CAAACTGAGCAGCAACCCCGGCATAGTCGTTTCCGTGAAATAGAACCGAGGAATTCGTAGACTATTGCTTAGGGCCTCCAGCAGTGCATTTGCCGACATT
CCGGTCGATGAGCTGTTACTGCTGTTGCTCGCACTCGCAGAATTATCCGGTAAAGTAATTCCGACGCTACTCAAGCCTTCTTCGAGCGACGACGCATAAT
CTGTAGTATTGAAGAGGCTCCAAGAGGAGCCATGATCTGGAGCAGAGCTGTTCGCGTCACTGGTCGCCCACCCTGCTGGGATGTCTAGGTCGGGTTCAAA
CCTCTTCAGCGCCACGAACAATAGAATGCAAAGCAACGGGTTTAGCACTTCGCTCCACGTCGCGAACGGGTGACGTCTCTTGATCGTCCAGTTTTTCGCC
ACCAGCGCTCGGACCACTGGCCAGGAGCGTCGAGTCTTCATCCGTTGCCACCCGTAGCTCAATCAATGAACCACCTCGGTGAAACCTAATGTTTTTTTGT
AAAACACATTGAAACGGAAAAACTCCTCCTATTCCTAGTCAAGTGGACGCCAAACTAACACTGGTCCTGTCGTTATAGGGCCAAGAGGGTCCTCACTTTG
CTTCGTCCTCTTTTGCCTCGCGCTTGGCCTTCGCCGCTGCGATCTGCATGAATTACAATACCAATGATTGCATAGTTTTAGCGATTATTATCCTGGCTGT
AGTTATCAGGTTCTTTTGGTGGTCTTGCCTTGGCTGCCGTGGCCTCTTTCCGACTGCCAAACTTGCGATTCTTGCCGTGGATGCGGCTCGCCTGTCCGCT
GGGTGGTGGCCGCGATGGCCTGCGCCGCCGTCTCCTCGCACGCCTGCTTGAGCTTCAACGCCACGCGCTTGTGCTGGATGTCCGCCATCGTCTTGGAAAG
TAACCCAAGGTTACGTATCGACTTCCACCGTAACTTTACGGATTACGCGGGTTACGGTAACCCGCGTAATCCGTAAAACATTGCAACTATTGGCGAGCGG
CGATCATGATGCCCCGAAGCAGCGTTTCCTCCGTCAAGAAAACGGCGTCGACCACGGAAGGTGCGTGGCCATGACAATAGATTGATTGCAAAATGGTTAT
GATGCTGATTGCAGTGATTCACTCTGTGGTGACCTTGCAGCGCCAATATGGAAAGCGTATCTGGCCATCCGGACGGGCAATGCTAGTGGAGCTCTCAATG
CCGGCAACGCAGTTAATTATACAAGAAGAGGCAGCAATAGTGA