Description :
From Genome Similarity Track
Location :
Scaffold_84:75178- 80589
Transcript NameFunction/comments
Hyaar_Emoy2808613hypothetical protein

Sequence
5411 bases(100 bases per row)
GTCGCAAACCTTGCCTAACCTGGCCTAGTTTCTCCAGGAGAACTTCCATACGGAGGTTTAGTATGCGCTGTTGACAGCGACAACAGCGCTGCGCAATCTC
TCCTTCCAGCTGCTAAGGCGCAGATGATGATATAGGGACTTGTGGAATTTTTGACAAACGCAGTAGGCCATAATAGGGACCACATTACCATAAATCTGCA
GAAAATAACGGACAAGACCAGGGATAGCAGAGCTCGTTAGAGGGTACAGAAAGAGATGAAGAGCGAGTTACTCAGTTTAAGCAGATAAAGTTGAAGAGAT
TTTGGTAGACACAAGTTATAAGACTCGCAAAGATCCACAGTACGTAGAGTTGGGTCCTGGAACGCTCAGTTGTTTAGTGAAAATGCATTAATTATGGCAG
TATTAATCGTCGAATGTTCTACTGTGTATGTAACGTGAACTAAAGTTGTCAAAAAATAAAGGACGCTGCAGCCGTAAGTATTGATATCTTTCCATATGAT
TTAACACAATGAGACACAGGCGTAATTATTGGGACGTAATCAATACAATTAAGGACGTAGACGTCTTAATTCGGGACACAACAACCTTTATTTGACAAAA
AATGCCATTCTATTTGCTTAATGAAAACCTTTGATCGGTAAATGCCTTTATGGATAACCGGGCGTCATCGGCCAAATTAGCGATAATGCTTAACCATTAT
CAACCGATAAATCTGGTGATACGCAACGACAGGAGGCGATAAATGGGAAAAGCAGGAGACTTGGTCTTCAATACAGATCCTATGCAGCAAGATTGAACAA
TTACATCATAGAAACAGAGCAAACTTTCATCACTAATTCTATGGATTGCGGTAGATGTTGCGTTAAGTCCGTCTCTTTTGCTTTAGTTACCCCCAGTTAT
GGTACAGATGCTAATATTTTGCGTCACGTTCCTGTTTTAAAACCTTGTTGATTGCAAATCTTGGGGGTCACGTATAGAGGTAAAATAATGAAAAATCTTC
TATATCTTCTTCCCCGACCCTTACGTGAAATGTGACCATTTCAGTACAGTTCACCGCGATCACATCAAGCAGGGACCTTTTTACCGCTCCGGTGCTAAAA
AATATTCTCGGTGACAATTCTGTCTCTTTTTCGGCTGCGACGGCATTAATGTTTTAGAAATGTTGTTTCCACCAACACATTTACTATTTCCACCACATTA
TAACTTTTGTTTGAACAACGGCGCACCACACCACACTACCACATTACTATATCACTCGCACACCCGATTGTAGTCACACCTGCTACGATCGGCGCACCCT
CAAATCGCCTATTCCAAATTTAAACGTAAGGGTGCATCTACAGTGATGCCCTGTCTCTACCTCTATCCACCCCCACAATTTTATCTAAACCCCTCTTGTT
GTGCAACACGTACTGACTTATCTGAACTCCACCCGGTTTTTAAACGAGCTTTGAACCTACATCTTCAACAGAAAGGCATATCTCAATACGCAAACCGTCT
TTGCTATTCGAGACGCGTTTATAGATCATGTCAAGAAGTATGGCCAAGATCCATATCCTTGATCGTCTGCTTTGTCATAGAATCACTAAGACCCTTCGTT
ACCGACATCGTATCATCTCCCGCCTACCTATCTTGATCTTCCCACAAAACCGAAGCTTTATCAATTCGTAACGACGAAGCGACTCCACATCGTCGATAGC
ACCCACTTGTGATATAAAAAGAGTAGAATCATTGGACAAATCGATTGTCCATCTATCTAGTGATAATTTAAAAAAATGGGTGATGCCTGTTTCCTAGTAA
ATTCATAGTCGCGCGCGACTTGCCGTTCGATCTGCTGAGCAACGACGAACAAGATGCTGACTTTTAGTGCCTTTAGTTCTTCCTGTCACTATATTGTGCA
TTGTAATACGTCTTGGGACGCATCAGAAGCTCAATGTGTTAAAACTAGCGGGATTTGCCGCATCGCACAAACTTCGTGTACAGCATAGCAAGAGACAATT
TATCGTCTTCTCGCTCAGGTAGGAGCTGCTGGGATAAACCAATCTTTGCAACACTACAATCTCTTGCAGAAGCTGGACCGTCAGCGTCGAATTCGGTGGA
ATACTAAGCACCTCTGTATGTGGCGTCACGTCTTTAGCAATGTTGACACCTCGCTCTGCAGCGTACCCGTCTTCCTTATACTCGTATACGAATTCAGTAT
CGATCTCCACTTTGGTTTCTATATCAACCACTTGTTATAGCCAACAAACTCTTCACCAAGGGTATCGTCCAAAGCATATAAATCCCTCCCCGATTCAATG
TCTTGGATCACTCTTTATCCTTGAACTCGTTGTCATTCGTTTCTCGAGTGGAGAGCACTGGCGGGTACGCAATGGTCAGCTGAGCTTGCCATCCAACTTT
TAATTAGAGACAAATTGATGGATGGAGTTCTCTTTATTATGATTGAAAATAATGTGGAAATAGCGTGACTTCAAGACTAAAAACTAGAGATTGATTACCG
AAAGCGCGTAAGCCAACTATGGTAGGTAAAGGAGTCTAAGAAAGCTAACGGATCAGCTGAACCCTCCCGACAAATTCCCACACTTTAGGTCGACATTATG
GATGGAAAATGTCTCCTACTATCTTTATACAAGAGCGTGTGATAGTGTGGTGTGCAGTGGTGGGCCCGAAATTATTCAAACAAAAGGTATGGTGTGGTGG
AAAAAAATCCCAATATGTTTTCACATTAATTTTTAAAAGTACACTTTTCCAGCAGGTTTTTCAGGTAGATATCCACTTTGAATAATAAATGGACACGCTT
CGCGCTCTTGAAAAAATCGAGGCCATAGTAAACTAACTTCTGATGAAAAAGTGAATTGTAAATTGCGCATTAAATGATATATATTGACGACATCAAATAC
ATCTAATCCTGCTATTTTTTGGTGCAACTATAAATAAGTAATCTTGATCTGCAGCTCATCTAACCTTCCAATGTCTTACCCCTTCCTATGATTACTAATA
CTGATGCGGTAAAGATGGACTAATCGTAAAACATTTATAATTATTTGTTTTTGATGATGAAAGGCTCGGAACGTGTCCGCAAAATTATTCAGTCGTATCA
TCTCTAACGCTTTCGTCGTCAACTTGAACGATCTTGACCTTTTCCGGTGGTTTGGGTTGGACGACAACGGTAGGCACATCGGCCCCATTCTTAACAGGCA
TATATAGATGTCTCGGTACCAGATGTAGTATTCTCTTATCAGTGAGCATTTTCGAGAGCAATGGTTCTGCATGTCGAAACATCCGAAGATTGGACAATGG
CCATGCCATGTCAGCGCAACTCGCGTGATGCTTGTACAATTCGTTTGCAAGGCCAAGGAATTTACACAAGTTCTTCTGGTTCCTAGGACCGGCCTATCAA
CTATGTCATTGGCCTTTACAGGGTCTGCTCTCAGGGCACGCTTCCCTATAAAACACCCCAGAAAGGGAACCACTTCAGCATTAAAGATGTACATTGGAGT
ATTAGCGTATAGCTTACTAATGCGCATGCACCCTAGCACTGCTCGCAGTTTTTTGATGTGATTATCAACATCCGTCTTCCCGTGCTCCGCTCGACTTCGG
ATATATATATCATCAAAATAAGCCTGTGCAAAAACTAGTGAGGAGGAAACAGTTGCTTCACAAGACGATTGAATGTCTCCGGGGCATTAGAGAACCCCTG
CGGCATCACCATCCATTTCCAGAGCATACTACTCGGGTTCCTTATCGCTGTGAGCGAAATAATGCTAGCTTGCGTAAGCATTCGGTAGTTATTATCGACT
AGGTCGAAAGCTCTGTATATGGTGCAACCAACAATTTTGCTCAGGAGAACATTTTTTCTTAGGAATTAGCGTTTGCTCTGGGATAGTAGCCGCATTGGGC
TTGTTGTAAGCATAAAAACGTGCCACTTATGATCACACAGAATGTAGGTGTAGAGTGTGGAGATTTACTCTCACGCACCATAACTACCGTGTGCTTGAAC
GAAAGATCTCCTCGATAACATCTCCCAGCACCATAGGAAAATGCTATTGCTGTGCAACGCCGTATTTCGTTCCAAAAACCAGGTCAATTTCATGACGTAC
ATCTCTGTCGGGAGGTAAGAACGATGGAGGCCGTGACACAACACATATTGGTACTCTTTACCAGAGGCTAGTAGGGATCGATAGGATCCTTAAGAATGGA
TGATCCACTACGCGATATAGTATCGTCTTTATATTATTAAGGACAGCTTCATATCAAATAGATGATTCATTCAACAAAAATACAGGTCGAATGACTACCA
TATCGGATAGATCACGAGCCATGAAGGTCTAATAAAACTCGTTTAAATACATTTCGTCCAACTCTAATAAGCATGTAAAGATGATAGAGGCGACAACGTC
AACGTCACCATTAACATCACATGTACTCCGTTGAATAGGGTACGTAGCTGTTTGCTATCTTTACTGAGTGACAAATAGACGCTTTGCGTCTCGCAACAGC
CATATGGCGTCGCTGACGTCTCTGCGTTGAGACTAAACACATCGGCGGGATTGGAACATCTGGTTCCACAAAATTATAAGACTCTACGACTATGATTTTC
TCTATACGAGAGCTGATGTTATTACCGACATCCGAAGAAAAGTTACCATACTCGAACTCATCACCCACTGGACTACGTGCCACTGTACGCGCATCAGTTG
AGAATAGCTCTTGATGGCTTGAGATTCAGTGAGACGCTCTTATAGTCGCCCCCTCTGTGAATTTTTGTCGTGCAACTGCTCATGCATGATTGAAAACGGC
TCTTGACCAGTTGGACCCAGCCCAACAAAGCATTCAGCATTTAGCGACTCGGTATCACAACGAGTATCACTCAACGGAATACGTGCCGATTCAGTATCAG
TCACTGAGCTTTGCTCAGGACGAACGTGATTAACATCATCCGAAATTATAGGCTCTGACATTCCGATGCTCAGCACACGGAACGACTCACCCAGTTGCTC
GCGCGAATAGCGCGTTTGTTTTTCATCAGAGGTCACTTCACGACTCTCCAAAGCTCCGCTGAGAACATTGCGCGTCGCGCCTATATTCTTAGACTTCCAA
TCAATTCAGGGCTCATGTCATTCGAGCCAAGGCATACCAAGAATGAGATCATATCCTCAGTCAAGCCAGGACAAGACCATGTTCGATGATGCCGAAGTCT
AAATATTTGACTCTTAACTTCAACGAAACTTTAGCGGTGGTGAGGCGTGCTCCTATCGCTAGACGGACCGCGATATTATCACTTTCTTGAGCTCTAAGCG
CCTCATCATATCTCTGAATCCCTTCAAGGGAACAGCGTGGGACATAATGAGCAGACACACCCGAGTCTATTAGAATTGAAAATGGCCCCAAAAAGCCTTT
CACTGTTGCTG