Description :
From Genome Similarity Track
Location :
Scaffold_903:7516- 10575
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_903-abinit-gene-0.12Dynein heavy chain
Pytiw_DAOMBR242034maker-piw_contig_903-snap-gene-0.4GTPase

Sequence
3059 bases(100 bases per row)
GTGTCGAGCACCATGACGCTGTTCAGGTACGCGCCCTGGGCGGTGCCGGACTCGGCCAGGTCGCCGCTGTTGCCGCCAAACATAAAGACCTTCCAGAACG
GGACTGCGGGCACCCCCACGCAGGTGTGGTTCCACGTGGGCGACGGCAATCGCACACTCAACAAGCTCCACGTCTTGGTCGCGAGGTCAAAGGCGAAGAT
GTCGTGGAACTGCTTGAAACTGTTCCAGCCGCCGATCACGAAGAGCTGGTCGTTGACGAGGCACGTTTGGTGGCCCGAGCGTGGCTCAGGTTTCTCGCCC
TCGGTCTGGATCTCCTCCCAGCGGAACGTGACGAGGTCGAGGGCGTGGAGGTCGTTAAAGTCCGTTCGGCCGTAGCCATTGCCGCCGTAGCCGCCGAAGA
TGTACATCTTGTCGCCCACGAGCGTCGCCGTGTGGGCGCCGCGGCACTGCGGGAGACCGTCCCAGAGCCCCTGCGCGTGCTTCTGCTCCCAGACGTGCAG
CTCCGTGTTGAAGAGCCAGAGGTCGTTCATGCGCTTTTCGGCCGAGAAACCCCCAAAGACCACGACCTTCTTGTCGTGCAGCACGGCTGAGTGGCGCCAC
CGCGGCGGAGGCAGGTCCTCGGGCCCATTCACGCTGGGCACTACCCTGGACCACGTGTATCCTAGGTTATCAGGTCAGGCTCTGGTTAGTTGTGTGACTT
CGAGAGACTTAGGAGAACAAGCATACGGTACCATTGTTGATCTCCATCCTGAACAGGTCGTTCGTTGGCCCTGGGGGCGACTTGTGGTCGCACCCGCCAA
ACATGTAGACCGCGGTCTCGGCGTCAGTGCTTCGGAGGGTGAACGAGTGGCCCGAGCGCTTGACGGGGATGTCGCCGCTCTGCTTTGGCACGAGCCAGAG
CAGCTCGAGCTCATTCCCGAACCCCACGGGCTGTGTGGCGACGACAACGACGCGCAGGTTAGCATCACTACTGACAAGGTTTGGAAGAAAATGGAATGAG
TTGACTTACCATGATGGAGCCTTGTAGATATCACCAGCAGCTAGCGTTCGCACGCCTTCTGGATGACTGGGTCGTGTTGTTCTCAACCTGCCACCGCCTC
TGCTACCTGTCGAAGCTCGCTCCACGTGCCTCCCAAGGAGTCTTTGTGAGCATCTCGATTGCTTGGAGCCAGAAAAAGCAAAACCTCTTGAGACTTCAAG
AGTCGCTGCGACCAGTCACGCATAACATAACGGAGCCATTCCAGACACAGACAACACAAGTCACGCGTACGTTCGTGAGGGAGCTTGGCAATATATGAAA
TTTAGCGCCATTGAGGACGACGACAGCATGTATGAGCCTCGGCGACCAACCTGTGACGAAGTTGGCAAATCAGATGCCATTCATTCTGGCCAAGAGATGA
TGCACGGACTCTCTGTCTTGGGTCTCTAGTTGTTGAACTTGAAGAAGATGATGTCTCCGTCTTGCACCTAAGATCACACACAGGAAGTCCATCCGAGTCA
GACACTGCTGTAGAATGAACCAGAGTCAGTCACGAGCGTACCTCGTAGTTCTTGCCCTGGAGTTTGAGCTTGCCGGCCTTCTTCACAGCCTCTTCAGAGC
CCACTGTAGATAATCAATCATCATCATCATAATTAGTACCTACGCCTTCACACAAAGAATCATAACAAGAGCTCAGTAGCACGTACACTCCTTGACGTCC
GCGAACGCCTGCACCTCGGCCTTGATGAAGCCCTTCTCAAAGTCCGAGTGGATGACGCCGGCCGCCTGTGGGGCCAGTCGGCCCTTGCGGATCGTCCAGC
TGCGCACCTCCTTTCCGCACGTGAAGAAGTGGATGAGGCCGAGCGCCACATAGCCCACCTTGAGCACGCGGTTCATGATCGACTTGTGGTCCGGGTTCTC
CTTCTGGTACGCCTCAAGCTCGCCCGCCTCCTCCAGCTCGAGCATCTCGAGCTCAAACTCGCAGCTGAGAGGAATCACAGGCTCGTTGCCACCGCGCGCC
TTGACGAACTCGGCGATCTTGGGCAGGTACTTGTTGTTCTTGCGCAGGTAGTCCTTCTTGCTCACGTTGATGAGGAAGACCACAGGCTTGGCCGTGAGCA
GCTGCAGCGGGTTAAGGATGTCGACCTCGAAGGCGCTCCACTGGCCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCCACGTCCTTGCCAGACTCCAAGTGCTCTTTGACGCGCACGAGCGCCTCGAACTCGAGCTTCTTCTCCTTGCCGCCCATGCCACGCTCGACGTTCT
TGCGCATGCCGTCGATGAGCTTGCCCACGAGCGCAATGTCCTTGAGCCGGAGCTCTTCCTGGATGATCTCAATGTCGCGCACCGGGTCGACGTTGCCCTC
GACGTGGGTCACCTCGGACGAGTCGAACGCGCGCACCATGTGGTAAATCGCGTCGACGGCCTGGATGTGCGACAGGAACGCATTGCCGAGGCCCGCACCC
TCTGCGGCGCCCTTGACGAGTCCAGCGATGTCCGTGATCGCGATCACTGGCGGGATGCTACACACATACACACGTATAGACAGAGAGAGCACACTATGAG
CACTGTGGCATGGGCATCTCAAGCGCTTCACTTGCACACGTACACGCTGGTGGCCTTGTACTGCTTGACGAGCCAGTTGAAGCGCTGGTCCGGGAGCGGC
ACGACGGCCTCATTCGGCTCGATCGTGCAGAACGGGAAGTTCTCCGCGGGGATGTTGAGCTTCGAGAGGCAGTTGAAGAACGTGGACTTGCCAACGTTGG
GCACGCCCACGATGCCGATCTTGACGTTGTTGCCCGGGCGGCCGAGGTACACGCGCTTCTCCTGTAGAGATAGATAGAGTAAGCGCCACGTGTGTATGAG
TAGTGAGAGGAGCTGCTCGCACGCACCACTTCGTTCTTCTTGGGCGGCATCGTGACAGA