Description :
From Genome Similarity Track
Location :
Scaffold_86:75153- 76698
Transcript NameFunction/comments
Phyra_83295Hypothetical protein

Sequence
1545 bases(100 bases per row)
CTTAGAACCTACTTTTTGGGGTCAGATTGGCCAAAAGTCGGGAAAGGCACAAATATTTGTGCCCCCCCCCCCCAAGGTGGACCTTATCGAAACCTGAAAT
CGATAAAGTTGAGTGGACACGATAGGCGTCATCACAGCGTCGATTTGATCATGTTTTGCCGTTTATTAGATGTAAGTGGTGGCGAATACGGACAAGCAAC
CTTCTTCACGCATTTTATACAGAAGGAGATCTTGCGCAGATTGTGGCTTCGACCTATGCCATCTCGGACCTTAGTTGCAACCTTCTTCGCGCATGTATTA
CACTTGTCACTCTGGATCAAGGTTTGCCGTTCAAAGGCCGAGTGTTGTCTGCAGTATCCATGACAGTTTCTTAATCAACCCACAATATACACATTGGTTG
CACATAGCAGACCTTGCATGGCAATGTAAAATGCAAAATGGAGCTGTGGTGCTGGACCCGAAGTCGTCGATAACGGTGTGGTCCACTTGCCGGAAGAAAT
CAACGTACCAAAGGTCCTCAGTGGTAGTTTGGTGTGCGGGAGTTCGATAGAGAAAAGTAAATCGCTGCCGATGCAATCATCATTGGCGAAGTGTAACATC
CTAGTCGCCACGATGTACACGAAGTCTCGGACCTTGGCCTGACTGGATCCTTGTTTATTGGGAGAGCCACAAATATATTTGGAAGGTAGTTTGACTAGTC
AAAAAGAGACGATTGTGACGCAGTATCCGATTGTGAAGATGTCGAAAACGCCTTGTATGCTCGATACCCCGTCGCTTGGTCTTTAGCAGCTTCTTTTGCA
TCCCGTTTGGTCGCTTCATTGACACACTTGGCGCAAAAAGAGATCTTGCGTCGTATTAGCTGGTCGTCTAGGGTGATAAAGCTGATCCGCCTGCGAATCT
TGCACGAGTAGCACACGCAGCCATAACATAATTTGCATGTGCTTGACCCTATGAGTCCTCTGATCCCCGAGGTCACGTTCTCCGTGCACATAATGCACTT
CTCGTTATTCATTTGCGTTCGACGGTCAATAGCCGAGTGTCGATGCTGCAGCATCCACGATAATTTCTTCATCTGCCCACAGTACACGTAGTTCGTCGCA
GACAGCAGCGCCTCAGCAGCTACCTGAATCGACAGGAATCGTGCGATCTTGCCTCCAGGAACCACTGTGCCTTGCGCATAAATGTCGATAGCATTTTGCT
CGATTTGCCGAAAGAAGCCGAATACTGAAAGGTTTCCTCGAATCATGCCCGGCAGCGGCTTGGTCTGCGGGAAGTCGATAGAGTGCAACAAGTGGTAGCC
CACTCGCTCACCACTGGCAAAACGGAGAGTACCCGTTGCCTCGATGTACACAAAGTCGCGACATTTGACAAGACTCGTAGACTGCAACGGTACGTCAATT
GTCATCCACTTGATAACAAGCGAGCGGAACGGTTCTTCCTTGCTTGGTGTCACCACGGGACACAGAACTGCAGCGCTGTCGAGGTCACGCACATACGAAG
CCTTGATGCGCATCACGTCCAGCGTGGGGTTCACGACGCCAAACA