Description :
From Genome Similarity Track
Location :
Scaffold_52:75143- 76975
Transcript NameFunction/comments
Phyra_50424RNA helicase family protein isoform 3

Sequence
1832 bases(100 bases per row)
CTGCCTATTTTCCAGTGTCGTGAAGAACTGCTGCAGGTGATTCGAGAGAATCAGATTGTGGTGATTGTTGGAGAAACTGGGTCGGGTAAAACCACGCAGT
TAACACAATACCTACACGAGGAAGGATACTCTAAGTTTGGCACCATTGGATGCACGCAACCGCGTCGTGTTGCAGCAATGTCGGTGGCCCAGCGTGTCAG
TGAGGAAATGGATGTGACTTTGGGTGACGAAGTGGGTTATGCTATTCGATTCGAGGACCTTACGTCGGACAAAACTATTATCAAGTACATGACGGAAGGT
GTGCTGTTGCGTGAGTCGCTGCGTGAGTCAGACTTGGATTCCTACTCGTGCGTGATCATGGACGAGGCCCACGAGCGAGCTCTCAACACGGATGTGCTTT
TCGGTATCTTACGCAAGGTAGTCCAACGTCGCAGCGACTTCAAACTTGTTGTGACGTCGGCTACGTTAGATGCTGACAAGTTTGCCGATTTCTTCGGTGG
TGTGCCCATGTTTACCATTCCTGGCCGAACGTTCCACGTAGATACGCGGTATGCCAAGTCACCCAACGACGATTACGTGGACGCTGCTGTGAAGCAAGTA
ATGCAAATTCATTTGTCGCACCCGCCGGGTGATGTCCTGGTGTTTATGACAGGTCAAGAGGACATTGAAGCTACCTGTTACGTGCTAGCGGATCGAATGG
GCAAGCTAGACGGTGCACCCCCACTCATGGTTCTTCCCATGTACTCTCAGCTGCCCGCAGACTTGCAGGCAAAGATTTTCGACGCCTCCGACGTGAGGAA
ATGTATTGTCTCAACGAATATTGCCGAGACATCACTTACTGTGGATGGTATCAAGTACGTTATCGATGCAGGATTTTGCAAGGTGAAGGTGTACAACCCT
AAGATTGGAATGGACGCGTTGCAGGTTAGCCCCATCAGTCAGCAAAACGCCAATCAACGTGCTGGTCGTGCTGGTCGTACAGGCCCCGGAGTGGCCTACC
GTTTGTACACGCAGCGACAGTTCGTCAACGAACTACTTGAAGCGCAGATTCCTGAGATTCAGCGAACGAATTTGGGTTATGTGGTGTTGTTGCTCAAGTC
GCTGGGAGTCTCCAACCTGCTGGAGTTCGATTTCATGGATCCACCGCCGCAGGATAACATCATCAACTCCATGTACCAGCTTTGGGTCTTAGGAGCTCTG
GACAATACTGGTGAGCTTACAGAAATTGGCAAAAAGATGGTGGTATTCCCGCTGGACCCACCTTTAGCCAAGATGTTGCTATTCAGCGAACAGCTTGGCT
GCTCTGCCGAGGTGCTTGTAGTCGTTAGCATGCTGTCAGTTCCAAGTGTGTTCTTCCGCCCGAAGGATCGCGAAGAAGAGAGCGATGCTGCCCGCGAGAA
GTTCTTCGTGCCTGAAAGCGATCACCTTACACTGTTGAATGTGTATCAGCAATGGGAAGCCAACCGCCACTCAGCCCAATGGTGCTCCGATCACTTCATT
CACGCGAAGGGCTTACGCAAGGCTCGTGAGGTGCGCGAGCAGCTTGTAGACATTATGAAGCAGCAGCATGTGCGCCTTCGATCATGTGGTGGGCGCTGGG
ATGTTATTCGTAAGGCAATTTGCTCTGCGTACTTCTACAACTCGGCGCAAATTAAAGGCATTGGAGAGTACGTAAACATGTTGACGGGCATGCCGTGCAA
CTTGCACCCCAGTGCTGCATTGTTTGGGCTTGGTTACACCCCGGATTTCGTTGTGTACCACGAACTCATCTACACAAGCAAAGAGTATATGCAGTGCGCT
ACGGCTGTGGAAGGTGAGTGGCTTGCAGAGCT