Description :
From Genome Similarity Track
Location :
contig_24:751055- 752296
Transcript NameFunction/comments
g4682.t1hypothetical protein

Sequence
1241 bases(100 bases per row)
GCAGCAACCCCGGCATAGTCGTTTCCGTGAAATAGAACCGAGGAATTCGTAGACTATTGCTTAGGGCCTCCAGCAGTGCATTTGCCGACATTCCGGTCGA
TGAGCTGTTACTGCTGTTGCTCGCACTCGCAGAATTATCCGGTAAAGTAATTCCGACGCTACTCAAGCCTTCTTCGAGCGACGACGCATAATCTGTAGTA
TTGAAGAGGCTCCAAGAGGAGCCATGATCTGGAGCAGAGCTGTTCGCGTCACTGGTCGCCCACCCTGCTGGGATGTCTAGGTCGGGTTCAAACCTCTTCA
GCGCCACGAACAATAGAATGCAAAGCAACGGGTTTAGCACTTCGCTCCACGTCGCGAACGGGTGACGTCTCTTGATCGTCCAGTTTTTCGCCACCAGCGC
TCGGACCACTGGCCAGGAGCGTCGAGTCTTCATCCGTTGCCACCCGTAGCTCAATCAATGAACCACCTCGGTGAAACCTAATGTTTTTTGTAAAACACAT
TGAAACGGAAAAACTCCTCCTATTCCTAGTCAAGTGGACGCCAAACTAACACTGGTCCTGTCGTTATAGGGCCAAGAGGGTCCTCACTTTGCTTCGTCCT
CTTTTGCCTCGCGCTTGGCCTTCGCCGCTGCGATCTGCATGAATTACAATACCAATGATTGCATAGTTTTAGCGATTATTATCCTGGCTAGTTATCAGGT
TCTTTTGGTGGTCTTGCCTTGGCTGCCGTGGCCTCTTTCCGACTGCCAAACTTGCGATTCTTGCCGTGGATGCGGCTCGCCTGTCCGCTGGGTGGTGGCC
GCGATGGCCTGCGCCGCCGTCTCCTCGCACGCCTGCTTGAGCTTCAACGCCACGCGCTTGTGCTGGATGTCCGCCATCGTCTTGGAAAGTAACCCAAGGT
TACGTATCGACTTCCACCGTAACTTTACGGATTACGCGGGTTACGGTAACCCGCGTAATCCGTAAAACATTGCAACTATTGGCGAGCGGCGATCATGATG
CCCCGAAGCAGCGTTTCCTCCGTCAAGAAAACGGCGTCGACCACGGAAGGTGCGTGGCCATGACAATAGATTGATTGCAAAATGGTTATGATGCTGATTG
CAGTGATTCACTCTGTGGTGACCTTGCAGCGCCAATATGGAAAGCGTATCTGGCCATCCGGACGGGCAATGCTAGTGGAGCTCTCAATGCCGGCAACGCA
GTTAATTATACAAGAAGAGGCAGCAATAGTGACAATGTTCG