Description :
From Genome Similarity Track
Location :
Scaffold_24:75105- 76266
Transcript NameFunction/comments
Phyta_totarag1334hypothetical protein PHYSODRAFT_505814

Sequence
1161 bases(100 bases per row)
TGGAAAATATTTCGAGAAAGTAGTTCCACAGGAATTCGGGGTGGCGGAGAATTGGTATTTTTTCTTGACGAAAGCGTATTGGTGTCCACAGGCTTCAACG
CTGGTGTCAGCTGAAGAGGTAGTGGATAATGAAGAGACTGAGTTAACGACTAAAAATGATGGTGTTGAAACGGTCCGACAAGACCTGGAGATGCAAGAAA
GTAATGGTCGCGCAGTGGTTATCAGCGGCTTGCGCAAGGAGTTTTCAGTTCCTGGAGGGAACAAAATAGCAGTGCACGGCCTGCATTTGAAGCTCTATGA
AGGCCAGATCACCTGTCTGCTCGGTCACAATGGAGCAGGGAAAACAACTGTAATGTCCATGCTTACTGGTATGACACCACCATCTAGTGGAAATGCTTGG
GTCCGTGGTTATTCTGTTGTCACAGATATGCGGAAAATCCGCATGTCTCTTGGTTATTGCCCCCAGCACAGCGTGCTTTACCCGGACCTGACCGTGAAAG
AGCACCTGACATTTTACGGGCGTCTCAAAGGTTTTACGGATGCGACTAAACTCGCAGCAGAAGTCACCAAGAAGATCGATGAAGTGGGTTTAGCAGATAA
GACCAATGTTCGATCACATGCGCTGTCAGGTGGAATGCAGCGAAAACTGTCGCTTGCTATTGCATTTCTGGGCGATAGCACGGTTGTGTTCCTCGATGAA
CCGACAGCAGGCATGGATCCGTACAGTCGTCGGAGTACTTGGGAGCTTATACAGCGCAATCGTTCAGGGCGCGTAGTGATCTTGACAACACATTTCATGG
ATGAAGCAGACATACTGGGCGACCGGATTGCCATCATGGCGGAGGGGAGGCTTCAGTGTGTCGGCTCCTCGTTGTTCTTGAAAAAGCGGTTTGGAGTGGG
CTATCTTCTCAGTTTCGTGCGACAGAGTGGCGATGGTAGCTCGGTGTTGCCATCTCAGTCAATTTCACTTGCATCGCTAATTCGACAGCATGTGCCTCAA
GCAAGTGTTGCGTCAGATATTGGAACAGAATTCACTTTTCAGTTGCCCTTCGAGGCGTCTGGTTCCTTTCCAGCATTATTCCGTGAGCTGGAGTCTCATC
AAGCAGAGCTCGGTATTCTTTCTTTTGCCATCTCGGTCACAACACTTGAAGAAATTTTTCT