Description :
From Genome Similarity Track
Location :
Scaffold_73:75093- 76610
Transcript NameFunction/comments
Physo_139354hypothetical protein

Sequence
1517 bases(100 bases per row)
GTGCACCGCACGGCCAACCAGGTACAAACCAAGATGGCGGAGCTGGAGCTGTCGTACCGTGAAGCTGCGGAACGCCTGGCCAGCACCAAGCGCGAGCTCA
AAGCGGCCGAAGGGACGCCGGCGGAGCGCAACTTGCGCCGCGTGCTGGAGCGCCACTGCCGCTACTTTGCCCTGCTGCAGCCCATTATGAAGGACATTGA
CAAGGAGGTGGATTCGCCGCCGTCCAAGAGGCCGAGACTTAGTACGAAGCGGAAGTCAGTGAAGGTAGCTCAGCAGCCAGTAGCGGCTGCGAACCTTCCT
CCTCCAGCGCCAGTTCCAGCTCGAGCTCCTGCTCCTGCTTGCGCTGCTAGTCCTTCGCCTGCCAGGTTGCGGTCACGCTCACCTTCGCCGGCAAAGAAAC
AGAAGTCTCACTACCAGCTGCGAGATCGACGAGGGCTGGAGTCGCTGACGGAGGATATAGTCTGGGACTTTGACAACGAGTCCGTTGGTGGCGTGAGGGG
TCCATTTACTCCCCCGACGCCGCCGACTACGCGTCCAGTGAGGAAGAGCAAGAGCTTGGCGATGCAGTCCATTTCAGTTATGCAGCTGGAAGAGGAGGAG
GAGGAGCGAGGGCATGTTCGACGCCGACGGGACATTCCGTCCGATCCCGTGAAGAAGCGGCCGGCGCTGAGGTCGATTGATGAAATTGACCTGGAAAAGG
CCCGCGTGGAGCTCACACTGCGTCAGCTGGAGTTGCAAATGGCGCGCGATCGAGCACTCGTCGCTCGTGCCAAAGCTCGAGCACAACTACTCGACCAAGG
AGTGTCGCGGCGAGAGGTCGATCGACTCATGCCGCTCGGTATCTGAACGCATCCCCGACCCGCTCGGGGCACAGCCTGGCTGTGACAGCGGACCGCATCG
AACTGATCCCTTTGGTTTGCTGCCAGAAATTATTGCTGGCATGTTACGTTGATGAATGCGGAAGCCAGAACGTTGTGGAGATGAAGCATCGGCATTTATT
GCGGTTTAAATATCGAGTCAATTCTTTCATGACTCTTCTAATAAGCTACATGCTGCTGCCTGGGTAGCGTGCCGAACCCGTGATGTGGACGGCGTCTAGC
CCGGTGTTCTAGGTCCACCCTAGCATGAGTGGGAGAGGTTGAGTTGAGGTGTTTCCAGAGCTGAGCGAAAGTAGAGCTGGTGCCTTGCAGTGCAGTGCAG
TGCAGTGCACGGCTGTCGTCGCCCGTTGTCTGGTGTACTACGAGTGTAGTCTGGTTGTCCTGTGCAGGTTGAGTCGCGGTGCTGGTGCTGCATCGCTTAA
GCGTGGGCCGGGAAGGTGCGCTGCGAGAGCAGCACGACGAGCTCGAGCTTGGAGATCGGGGACACGTCGATGGGGCTGCGGTCCACGGAAGGGTCGGCAC
TGCCGATGATCTCGGGCGCCATGGCGAACGACACGCCCTTGCGCGCGCGGCGCGGGGGCTTGGCCATCATGTCCTTGCTGACCCAGGCGCAGTCGCGCGG
GCGCTCCTGCTTGGCGT