Description :
From Genome Similarity Track
Location :
Scaffold_1:750820- 753276
Transcript NameFunction/comments
Phyra_72797myb-like DNA-binding protein, putative

Sequence
2456 bases(100 bases per row)
AGTGTATAAATGATATTATCTCTCTGCGATCGGCTGGTACTGCCGTGCTCTTGAAGGGTTACGGATTGCCGCATTGGCGCAATAAATTAGGCGAGAAGCA
GGTCAATGGATTCCTGCACGTCTTGCCGGTAGGCATCGTCAGCCAGGAGCTCGTCGTAGGAAACTCCAGATGTGAACGGCAGCGGCTCCAGGTTGTGCAA
CACTGCGTCCGTGTCGGTGTCCAGGTCCAGACTAGAAATGCTGCTGGTGCTGCTGCCGGCGTCGCTGGCCACGGGGCTGCAACCGCCCGTAAGAAGCTGG
CCAAAACCGCCGCTCATTGGAGACATAGCGCCAATGGGAAAGGCCGAGGGCGAGCGCGGAGAGCCCTGCATGGTGAAGTTCTTGACGCGCTGGATGCAGC
CCGTAGCGTGAGCGTCCACGCGGTGCTCGGGGCGCACAAACTTCTTCTTCTGTTTGCGCAAGCCGCGTCGCCGGCGGTTGATCTTCTGCTGGTACTTTTG
CGCGTGGGTCTGCACCTGCTTGATGGATCGCGTGCCGATGAAGGCGGCGATGGAGCGCCACGGACCCGTAGGGAACATCTTCATGGCGTGCAGGAACTGT
TCGTGCTCCTGCTCGGACCAGAGGCCGCGCGTGATCGGCGTCGAAGGCGCGGGCGCCACGACGAGGTTGCCTACGCTGGCGGGCATCATGATCATGGCGG
CGGGGGCGGCTATGGTTGCTGTAGTGGTGGCGCTGGGCTACGTGCGTGGCTCGAGCGAAATTCGGGAATGGAGTTGATTGATGTGACCAGGCTGCCCGCT
TGGACACTTTTTTAGCTTTGCCTCACCTTGACACGCTGGAGGGGGATGGGCTCCGTCTAGAGCGGGTAGGGGTAATATATGGCTCAGAGCGATTCCTTGC
GAAAAGATCGACCAATAGCAGCTGTGCACCCGTATAAAGTACGACTGGCTCGTCTGTCTGTGCGCTGCGGTATCTCACGGTAATTTATCCCGCGCCGCAA
GTTTTCAGCACCAATTGCCTCGCAGCTTGAACGCTGAAAACAGCTTTCAATGCCAACTTGCGGAGCACAGTAGTCGCGCCGCTCAGAGGCCTGCACAAAA
CACTGCACGGCTATCCAGGTGTCGATATTTGCTGTTTTCATCTCAGTATGATACTGCGAGTTGCAGCGCCAAAACCGTCGATGCGAAATGCATTTCTCCG
CTGGAACAGCAACCTGGTGGACAAGCTGCATCATCGCAGGAGCATTGTTGCAACGTAAAGGACCTGCATACTTTCGCGTTGGCGTTCCTCGTGCGCGTCT
GGTGGCTCTGAGATGACTTCAGGGGCCTCCATGCGCAGATGTTGGAACGCTTGGCTCAGACGGATTGCTTCTGGTTGGAACGGCCTAGCTAATCGCGCCG
ACAGCAGCGAGCTGCTGTCTTAGCGCATATGCTGCCTGTCAGTTGGGTCGATTTGCGCCAGCGATAGCCTTGAAAACCAACTGATACGGAGACCATTTAA
TAAATTACTTTAAAAGCCTTTGTTGTGTCATATCTGCGACACACTCATGTCGCTCCGCAGGTCGCTGCGATTATATCCGTTTTTTTATTCATCTTGGCGG
TGCCACTCGCCAGAAAAAGATCGGCGAGTCTGCGTGGGAAATTGACGCTGCAGCAGGCGTTGAAGTTGCTTGGGATTTCTTTTTTTAACAGCGGCGTTCT
CAACGCCAGCGCTTGCATGGCACCACTCCGCTGAGCCTGACGCACTGCGCCGATCGAGCTTCCTTCGGCCTCCTTCGGCTTGCAACCGCCTCTTCTCCCA
CCGGTCTCGCATGGCTTTAGTCCTGCACAGTTGCCACGGGCATCATGCGCTGGTTGCTGACTCGGCTTTCGACGAACGCTGGTTGTGTATGAGACACCAG
CCGCCGCTTCCACTGCGGGCATGCATGCACGCCGCTTTCCTTCCGCGGGATGCGGCAAGAGCGCCGCCGTCGCCGCAGTGGCAAACGTGTTTTTTTGAGT
GGATTCCTGCCATCCTGCGACGGATGGGGGTGGCCCGCGAGCGGCATGGCTGCGAGCTACGCAACTCTCTAGTCTCCGCAGCAATGTTGCGAGCAGCGTG
CCGCAGATACCGCCACTTCAATGTGCCTCGCTGTAAACAGCGCCTTCACAGTCCAGCGCGTTGAGGCAAGTCGCCCCTCGCTGTGACCGTCGGGACTCGT
CCAGACTTGTCACGGGCAACGAACTTTCGTTGGGCTTCGTCCTCCTGGATCCGTGGTTGTGTGTACTGAAATAGTTTATGCAACAGCGTAAAGTAGTGCC
CATCCCCCCGCAAATCTTTTTTTGTGGGCCAATTTTCGCTCGGCCAAACTTTCGCTCGGCAGGAGACCATCGCAGCTCGGCGCCGCCATTGCCGCCGCGG
GAATGCTAGGTGTCGCGGTCGGATCATGCGGCGGATATGGCTGCGTGCGACACGAG