Description :
From Genome Similarity Track
Location :
Scaffold_691:7508- 9535
Sequence
2027 bases(100 bases per row)
GCCACCGAGGGGTCGTACCGTAGATGGTCAGTTCTTGGCCGCTGAATGCGAATTCGGCCAGTCCGTTATTATTAATAAGGACAGCCTGGATTCAGTGACA
TATGAACCGTATCCAGTATCCGTTGAGAGTTCGGTAGTGACGCCGTCGAGTCTCTTGCACCTTGGGGTCACCGTACATCACATGACCGAGGGTTCGTCGC
TTGAACATCTAGAGCGGTGCCGCATCTTTGTCGATGGGCGATTATCTGGAGAAATCACTACACCACAACTGCCCCTGTCGGAATGGAAGCCATGGTACTG
GTGCCCGTTGTGACATTTGTTTCATTCTCTAATTCACCGTCCAGTCGCAGCATGTCCAAGCGTTGAATCGGGCCGTGAACAGTGCGCCAGCGTCTTAATT
ATCGCCGACGACGTGAACGTGAACAGCTGGAGGTACGTCAACTAATCCTCCTCTTGAATAATCGGCACCTTGCTCATCACCATGCATTACTCGTCTTGTT
TCTCAGGAGGGCGACACCGAGGATTCGAACGAGTCTCAGCCTGCCACACTTCCCACGACGGCAACGTCGTCAGCTGGACCTCCGGCGCTTACTGCCCCGG
ACCCTTCACCTCCTGCTACAGCTCCTGCGGCACTTCCTGTCGTTGTTGGGTCTACAGTGATGGCTCTTGCTGATCCGCCTGAGCCTGCTGGTGGTCCTCC
ACCTCTCACCGAGGATTCCTTGCGCGCCATGCTGGCGGAGAGTACGGAAGCGTCGGTCGATCATATGATGACCTCAATTATTCCGTACTTGACTGCGATG
GCTCGTCATCAAGTGCAGCTCAACGTTGCGCCTCCTCTTCTCGACGATGACCACACTCAATGTCGCCTCGAGACTGCCATGGGTTTTGACGAAGTCCTCG
CCGCCGTACAGCCTCTTTTCGATGCGCTGCGGCATTGCCCGACCAAGTTATCAGCCTGGAGCGTCAGTTGCGAGCTGCCCAGACCGAGGCTTCTGCCGCC
GTACGTTCGGTGGCACCCGAAATCATGGCTCGCGAAAACGCGGATGCGTACCTCAAGGCTGCCAACGCCGAAGTAGAAGCGCTTCGCAAGGACGTCAAGA
TTCTCCGCGAGCCCAACGTCAAGAACGATGCCATGCTTGCGAGTGTTCAGTCCACCATAGAGCAACATACAGAGGACTTAAATCGTCTGCACTGCGATGC
CCAAGCGCGGGACGCGTTTATCGCCACCTTGAACAAGAAGCTGGCCCTTGAACGCGAAGTGTACAAGTCTTCGATTGATGCGAACACCGAACAGACTCAG
AAGCTTCATCTCTTTTTGGTCAAGCTTGCCAAGGAAAAGTATGTCGACAACGACACGCTCAAGGTCCTCGAGAACCAGCAAAATCGCAGCACTCGCCTCC
TCCAAGTGAACCGCACCCTCCGTGCACACGTGAGTCTGGCTGGGATAGATCCCGAGGTACTGCGTCTGGCTGTTGATGGTACGTTCCTCATGTCGTTCTT
TCCACCGTGAGCTCAGCAACCAACGTTCGCTCCCAATCCCTTGTGACAGATCTCACTGCGGGTGAGCTGGATCTGGAAGCCCTGGACTTAGGACAAGAGA
CGTTGGTTGCCTTGCAACGCATACAGTCTGCTGCCGCTTCTTCGAATGACCCTTACGCTCTTTCTGCAGCTTTGGCGCTGGCCGCTCGTCAAGTGGCTCA
TGGGAAGCCCCACAAGCGTCTCGACCAAGTGGCAAGGCGTCGGACGACGGGCTGGACGATTCTGACGAAGCCAAGGTCCCCATCCCGACCGACAAGGCCG
GTACGTCTATGGCAGCAGCTGGTCTCGGTGACACGCAACCTGCCGATACTTCAACCACCAAGTCCGCACGTCGTTCTCTGTTCAGCCCGAAGGCATGGAA
GCAGGCGGCTGAGAAGAAGCGCCAGAAGACTCGCCTTCGTTCCCTTGCCAAGTCGCCCCGGCGTCATTTGAAGACTCGGTCCCAGTCTGTACCGTCATCT
CTTCGCTCATGGTCGCCCCCTCGCACG