Description :
From Genome Similarity Track
Location :
Scaffold_11:750605- 753221
Sequence
2616 bases(100 bases per row)
AGTCGATGGGCCAGTCCAGCACCACCTGCGAGGAAGCCCGGCTCTCACGAATACCGACAGACCAGTGACTACCGTGCGGTGAATACTGAGACTGAAGCTG
CGGCGGGTGTGATGCCAATTCTTTTTGCCATTACGGAGCACGTATGTGGTATGGATCATTTCGGTTTGCTTGACTTTCTAAAAGTTTTTTGGCAGCTCCC
TTTGGCAAAGGAGTGTCAGGCGTTTCTTTCGTACATGACCGATAGTAAAGTGTATACACCTATTCGAGTGCCACAAGGATGTAGTGATGATGCGGTCCAT
TTTCAGCAAACGATGGAGACGTGTTTTAAGAAATTACAGTATAAGCACCTACTAGTTTGGGTAGATGACCTCCTACTGTATGGTAGTAAAATTGATGAGT
ACCTAGAGAAGCTTCAAAACGTTTTTCTTTGGTAAACGACTTTGGTTTGAAACTGAGTGTGAACAAATCTAGTCTATCAGAGAAGCGTGGGGTGGTGTGG
CAAAACTTTAGATTGCGCTGGAGTAACGCATGCCAAATGAGCGCATACGGTGACTACGGGAAATGTCGTACCCGCTGACGGCGGCAGACCTACAGCAGTT
CTTGTGAACAACTAATTGGCTGCGATAGCTACGCAGTAGCTGTAAAGCCACTTCAGCAGTGTTTTGACGTTGCACTCCGGAGCAAAAAGTAGTCGAAGCG
AGCTGCCGCCGTGGTGCATATAGTGTTAACTGCTGAGCTTCGAGTAGTTTGTGACAAAGTCCGTCGGTTGCTAGCTACATCTGCTACTCTACACGACCCC
AGTGCCGATTGAGACATAATGCTAGGCACGGATGCCTCTGACCAGGGCTGGGGCATTTTAGTGACTGAAGGTGAGAATTGGGACTCTACAAAGCATGTAA
GCGAGCAGTCTCACCGACGTTTGACGTGTCTAAGTGGCACATTTACTGATGCTCAAGTGAATTGGAGTATAATTGAGAAGGAAGCGTTCTTCCTAGTCAC
TGCCTGCGAAACGTTACAGTATTTAATGATGAGACCGAGAGGCGTTTGGATGTTCTGCGGTCACAGAAATTTGATACATGTATTTGCGCCTGCGGAGAAT
ATCAAGAAGCATATTCGTGGTAAATTCCTTCGCTGGGCACTGAAGCTGAGTGACTTTCGGTACGCTATCAATCATATCGCTGGGGCCGCTAACGTGTGGG
CTGATATGTTGAGCCTATGGGCTTGCCAGCCAACAGAACCTGTTCACGTGCGCCGAGTGCATACCCGTCGGGCCCAACAGCAGGAGCAAAGATCGCTCTG
CTCTCTGGACGATGAAAAATTTGTATGGCCGACACTTGACACAGTGTCGCGGGCTCAAAAGCGACACGTACCGCGGCAACTACTATCATGGCTGGTAGAA
CTGTCTGATGGACTGCTAGTAAAAGGAAAATTACTGTGGATACCAACCGAAGAGCATGCATTGCTGCGTCGGCGGGTGATTATATTGCATTGTGAGCCTC
AAGGCCATCGTGGTCGGCATGCAATAATGGCCCTGTTGGCCAGTGCGTTCTCGATTGAACGGCTCCGTGTGTACGTAGAGCGCTTCCTGGCGAAGTGCCA
GCTGTGTATGCACATTAAAGAACGGGGGGATCATTCCGAGTCCATGGGGAGATACGTACCGTGATCACACGTGGAATGAAGCGCTACATTATGACTATTT
ATTTATAGGTTAATCATTTGGAGTCAACCAGTACGTACTGGCGCTGAAGGACGATTGTAGTCATTTTTGTGAATTAGTAGTCTGTGAGTCACCGGCCAGT
GCCGTGGTCGCCGAGGCTATTCTACAGCGGCATTCCTGCCGCAGCTATGGATTAGTGACGAAGTGACGCACTCATTTCAAATGTGAAGTGGCTGACACCT
TGAGGAGTAAGCTGAAGTGCGATCACGAATTTTTGGTGGCATATTGTCCGTGGATAAATGGATCTATTGAGCAGCTAAATGGGATATTCTACAAGTTTTT
TTAAGTATGATTTTGGAGTACAAAGTGAACCATCGTGACGGGGAGTCACTGGTCTCTGTAGTACAGTCTAGCTTGAGCCACACACCTCTACCCTCGCTAG
CCTACAAGTCATCACTGAAACTTTTTACGGGGCTGTCGCCGCCGTCAAGTTTTTGACCATGCTTTCGTACGCAAACAAGGCCAAGGTGAGATCATTAAGG
CTGGGAGCTCTGACAAAATTGAGCGCTCGCTGGCGCAGCTACGTGCTACTATTCACAATATGCACAGAAATGTAAGTAATGCGAGGGAGAAGCAAACTTT
ATTGAACAAGAAGAAACGTGGAGAAAACTTAGTGAATTTTTCGGTTGGAGATTCTGTGCTACGTTCTCGAGTGGATGAGAAACACGTGAGCAAGCTTCTA
GTTACTTGGGTAGGGCCGTATGTGGTGACGGAGGCTCACCCGAGACATTTCGTGGCTAGCGATTTAGTGACCGGCAAGTCACGCGACGTACCCGCGTCAC
GGTTGACGTTCTTTGCCGATAGTGACCTAGAAGTAACTGGAGAATTGCTACAACATGTGACTAGCTAAGGTGTTGTGCTCGATGTGGACACGATTAAGCA
GCATCGTTGGAATGTA