Description :
From Genome Similarity Track
Location :
Scaffold_235:7505- 8554
Sequence
1049 bases(100 bases per row)
GAGACTGGGTACTCCTATCGATACCACTTTGGTCCGCGGAAAGGAGGAGGGTGCTATCCATGAACCCCGGAAGATCACGAACGACCTCGACCAGCAGCAG
AAAACTTCCAAGCTGCCCGGCGCATGCATGGGGCCCGGTGGTGGCGCCCATCAACCAGAGGCTGCCAGCAACTCAAGCGGTCATTGGCCTTCCGAGGAGA
GATCTGGGCTGACCTCATTCTGGAGATACCCGTCGCTCCTCGTGGCCTTGTTGGTGGACACGTTCACGAACGTGCCCTGGTCCAGAAGGAGCAGCTGTTC
GCCGACAACTTGGAGGCGCCCCGCTGCATCCCTTTGAAAGATTTCACGACTTGTCGTAAGAAGCCCGATAGCCGGGGTGGTCTCTACCCTCTCTGGGGTT
TCCCCTCGGTTCTTCCCGAGAACTGTTCCAGCTGCAACTCGTGTGAGGATATGTTCTGGGCGTGGGTTGATATTCTCAAGTACTCACCCTCGGAGTTACG
GGAGCTCCATGAAGATCAGCCCACATCGTGGACCAGCGTGATCTTCGTGTCCGGTTCGTCCACTTGGTCAGCAAGCGCATGCTGCCAAGCGACAGTCTGA
AGCGCACGGCTTCTAGCGCATACGAGGAGCGCGGGTACGGAGTGTCGACAACGTCCGTACCCCGTTCGGGCAAAAGGCCCCAAACTACTTACGAAGCTGC
CGCCACTTCTTTTCCCAGATTGCGACAGCCTTCGGGCAGTCTATCAGGAGCCCAATCACCTGGACAGGCTTCGCCTAGGCGACGGCATCCCAGGCTATTA
AGATGAGACAAGCCCGCGCCGCAACGCTGAGCAAACCAAATGTGAGCGCGAAGGTCCTAACTAAACAGGTCCAAAAGGGTTGAGGGCGTGCAAGTGGACC
AGCGGATGGGGTATCGTGTCCGGACCACGATAGGGATGGAGGCTAGTGGTGACTACCAGCGCTCCTGTCACAGATTGAGGTCGCTGTTGCAAGCGTTTAA
GACGGCTTCCCTTATGCCCAGGTTGTGTACGAGAACTACTCACGCTTGA