Description :
From Genome Similarity Track
Location :
Scaffold_223:7505- 8508
Transcript NameFunction/comments
g11673.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
ATGCTTTCGTACGCCGCCGGAGCGATTGTCAACTCTCTGTGAGAGAGCATCGACAATGGTCTGCATAGACCTTGCTGTCAGGTTCACATACCTGAACAGC
TGCGACCCGTACGTGGTCGTGGACACGTACGGCGTCCGCTTGGGTGCGCCGTGCCATGTACGCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCTA
GGCTAACCGGCACCCAGCTTCTGGCAGAGCATTGGTGAGTCATGACCCCACCTCTGCCAGAACACGCGGTATCCGAAAGGATTACCAGGACGCAATGGTG
TCCGCCGACGTACGGAAGTCGTCGGAGTAGTTGCAGCTGCAACAGGTGTTGAGACACCGTCCACTGCGGGCAATGGACCGCCACAGGCAATGCCGGTGGA
CAGGACTAATAGTCCAGCGAGGGGAGCTGCAACGTCAGCACCCACCGCTCCTGATCGTGGCGCCATACAGGCCTCGACTGTATCAGCGCCAGGGGATGTC
AGCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGCCGAGACCGTGGTCAGGGCTGAGGTTGCCGAGAGCACCTCCTGTGTGGGTAACAATGTGCC
ACACGGAGTCGATGAGATTCCCGCCTCTGCCCTTGAGTCACCACCGGCCGTGGGCATCGAAGAACCACGCCGGGGTAGGCATTGACGACGTCGTCGCCGC
CGTAAGCCGAGTCTGTTGAAACAGACTGGAGTCGCCACGAGCGACTCGGAGTAATCAACGCTCCTCAGGCACGGCCGGCCGAAGATGCTATCACATCTTC
GACGGCGAGACCTGTCAGGTCAAGGCGGCGGTCATAAGTTTGACCGCCCTGCCGGAGGTGTCAGAGTTTCTGAACCTCGAGGGAATGTCGCTGCACGACT
TCCAGGCCAGCATGAAGGCTGGGGAGATAGCACTCCTACCTCTCCTGAAGAGTTGAACTCTTCTTCTGTTCTGGACAGGAACGTCCTGGAAGAGTTCTGT
TGA