Description :
From Genome Similarity Track
Location :
Scaffold_8:75047- 76264
Sequence
1217 bases(100 bases per row)
GCCTCCTAACCGGTATACGTTTTACGTGCCTTCGTTTCCAACACGGGGTTTGAGGGGGGCGAGTACCCGAGCCAGCGAGCGACGGGGGGCCACGTATTCC
TTGCGGCTATACTTGCCGACGCTTGGTGGTTCTCAAGAACCTGGCGATCTTCCGGAGGGGAGAGGTCTGAGTGGTTCAGAGAAATTTCGGGACTGAGTCC
TTACCCTATCCTATGTCCTTGCTACTGGCTACTCCCTACTACTTGCTTGCTAAGCCTACCACTCACGCCTATCCCTGCGTCTGTCGTGCTTGCACTGCCG
CTCTTCAACCTGATTTGCGTAACGTAATCACGACTTGGGCTCGACGGGATTTCTCGACGGGGTTTAGGGTTGACGGGTTTTGGGGCCCACGGGTTTTGCT
CGGCGGGGAAAAGGGTCGGCTCGTTTTGCAGAGACGGGGCGCTGGTCGACTCGTCGGATGATTACGCGTCGAGTTGGACTCTGGCGCCGTGTATCACGGC
TTTCACCCGCATCGACTTTTCCCGTTGATCTCTGCCGCGCGCCGCGTTCCACCAACTGCATCGAGTTCCATCCTCCGCGCCGAGTTCCATCCTTCGCGTC
AATCGGCTTCCATCTCGGCGCCTCCTCTCACCGGCGTCGACGTGCCCGCTTCCTCGTGGGGCACTACACCACAACCGTCCCGCTGTCTCGCACGCGCACT
CCCCAGGCGGGTGTGTCGGTCGCCTTTCCAGCATCATGGTGCGCGCTGAGGACATCTACATCGAGGAGGGCGGGCCCGACACCTCGATGCTGCCGACATC
GACGTGGAGAAATGCTGAATTAGAATTGTTCTCTAAGAAAGGCGGCAGGGCCGATCGACTGGAAGTATGGGAGATCAGCGATCGAGAGACAGGCAGCAAG
GATCTGTGGATCAGAGGGAGTTCTTCGGGAGATCTCAAGTGGCCCGATGACGCCGGCGCGTAAGGCAGGACATGTGGCAAGCCGGATTGTGGATGATCGT
GCTCGAACCGTGGCGTGATTCGGGGTCGACCCAAGCACCGATCGACGACAGATCTCGCAGATCTAGGACGACCGAGGACAGAAGATGATGGATCGGCGGC
GCACGGCAACCGGCACCAGTCATCGATCGCGGATCGAGATCGATCGCAGATCGGGAGCCGATCGTGGGTTGATCGTGGATCAGGGATCGACCACGATTGG
ATGCACATGGAGGACGA