Description :
From Genome Similarity Track
Location :
Scaffold_84:75023- 76356
Sequence
1333 bases(100 bases per row)
CCGGTAGCGTCGGTTCCCTCTCAGCCGAGTTCGACTACATCCCGGCCGGCTTCGGTCACACTGACAAGCGCTCTTACACTCCCGCTGGCGACGTTACGGA
CCCGGGCCTCGCAAGCCGTTTTCAAGGATTGTCGCTTGACTCTTCACATGGCTCAACTCCGCGAGGTACCATTTATGCATTTCGGCTCAGCCCGTTGTTG
GAATGCGTTATTGGATACACTGAGCGGAGGGGTGCAGCTGGAGTTCATAGGTGGCAAGAGTCGCGTGCATACGAGCTTTCATGGCTGTCTTTGATCCGAG
TCATCCTTGTCAGCGTCTCCGGCGGATGCTTCCCAAACTTCCTTTCTTCTTTTTTCCGTCAGTGCTGGAGGAGGCTCGGCGGTGCTTGGCTTCTCAGACC
CGACCTCGAGCCTTGATGCAAGTTCTTGGAGATTTGTGGGTGAAGCTTCGTGGCGACAGTCCTTTGGACTCAGCGGGGAAGCCTATCAAGACAGATGGCC
AAATGACTCGTTACTTTGTTGCTCTCTACAAGCGTCGCCACTGGATCGTCGACTCAAGTCTGTTGATGGGTCTCCATCCCGACGTCAACCCGACTACCAC
GCCTGCTCGGCTTGCTGAAGTGTCTGAGCTGTGGCTGGTGTACAAGCGCGAGCGCAAACACCGTAGCGACACCCTACGATCTTTGGTTGTCGCTGTCTAC
GACCAGCTCTACTCGGCGGTCACCCAGAAGCTCGGCGGCGAACCTGCTCCTCTTGTAGATGCTGAGGTTTATTTCGATCCGCCCGTCCCCCATTACTCTC
CTGTTAACCTTTCGTGGGTTCCATCCGGGAGAGACTGGGTTCAGTGTGCTCACGATGTGAATCTAGCCGAGCCCTGGCGAGCTTGGTGGCTAACCGACCC
GGCGGCTCACCCGTATAACACATGCTTCCGCGCTCGGAACGTGGACTTCTTGGTTTTCGCTCCGCGCGGTATGGACCCTCAGGTTGTTGACGACGCGATT
GAAGAAGGTTTCGATCTTGCCGAACAAGCGCCTCCTGCGTACGCTCAGGGTGCTCTACCTCGGCTGAATCGTCAAGGTATCCACATCGTCGCTGGGTCTT
CAATCGGTGAGCTCGGCTCGGATGACGAGAGTGCGTCTGATGACGACTCAGCGGACGACGGGTTGGGTTCTCCCAATCTCCGAGGCGCGTCTCCGAGTAT
GTCTCTGTTCGGCACTCCACTCCCAAGTGGGACGGATCCGCCTCAACTCACTTCGGCGGAGTCGGGTTCTCAGGCACCGGTTCTTCTTCCACCTGCTTCG
GCGTCGGTCTCTTTAGCTAGCTCGGCGATGATA