Description :
From Genome Similarity Track
Location :
Scaffold_20:75022- 80679
Sequence
5657 bases(100 bases per row)
CGACCGATTCGATGCCCTGAGAGTGGTAGGGCCGAATGACGAACACCTTCGCGCCCGTATCATCCATGAGTACCACGACGCTCCGATCGGGGGTCACTTG
GGACGCGAAAAGACCTTCGCGGCGGTGGCGCGAGACTTCTTCTGGCCCCACTTGTACAAGTGGGTGCGCACTTGCGAGATCTGCCAGCGAGTAAAGCCCC
CGCCGTCATCGCAGGCTCCGCTGCGTCCACTTCCGGCCCCCACGGAAGCCTGGCGCTCCGACTCGATGGACTTCGTCTTTGGTCTTCCACCCGACTCGAA
CGGGCGCACGGGAGTCCTCGTTTTCGTCGACAGGTTCAGCAAGATGGTGCATCTCGTTCCCGTGGCTGCCACGGTTACTACGGAAGAGTCCGCAGCCCAC
TTCGTCGACGCCGCCTTCCGCCTTCATGGTCTGCCCGACTCCATCGTCTCGGATCGGGATCCGAGGTTCACGTCCGCATTTTGGACGGAGCAGTTCAAGT
TGCTTGGAACGAAGCTGGTGATGTCCACCGCGGCTCACCCGGAGACGGATGGACAAACCGAACGCGTCAACCGCGTCGTCGAAGACGTGCTCCGCAGCTA
CGCTACGTCGTTCCCGAGCTGGAGCGCCTTCCTGCCCCTGACCGAGTTCGCTCTGAACAACGCCGAGCACTCGTCGACGGGCATGACTCCATTCTTCGTG
AGCTCCGCGCGCCACCCGCGTGTACCCGCTATGCTTGCTATGAGCCAACCCACGGCGGCTCGTGCCTCTACGCTTGATGGGGGAGGAGCTGCCGCTAAAG
ACTCACCGCCAACCAAGACGCCGGCAGAGTCGTCGCCGGTCGAATCACCGGCGCCGCCACGCTTACCAGTGACCGAATCAAGCGCGAATGCAGTGACACG
ATCCCAACTGAAGAAGGCCCTGACTGCACCGCGCAGTGCGGTGACGCCGCTCGCAGACTGGACGGAGCGCACTCTGATCGATCCCGCTGGCGCACCAGCG
ACAAAGCAGCAACCGGCTATTCCCGCTAACTACGCACCGAAGTCCTCAGCGGGCCCCGCAGACCACTCCGCGGTCTCCGAGTTTGTGCAGCAGCGTCAGG
CAATCAAACGTTTCGTGCGGGACGCACTGCAAGCTGCAGTAGACAAGCAGAAGGAAAACACAGAAAAGCGTGGGCGCAAGAACAAGACTTCATTTCGCAC
GGGTGACCGTGTGTTACTGTCCACCGAAGGCATCCGCTCCTCCGCAGTGACCAACCTCGGTGCCAAGAAGCTCGCGCCGCGCTTCATCGGCCCGTTCAAG
GTGATCAAGGTCCTCGGCGCCGCGTACACACTGGACATCCCGTCGTCGCTGCGTCTTCACCCGACTTTCTACGTCGGGCGCCTCAAGCGATATTATACTG
CCGATATTCCGACCTCTGATCACCAGGATTCACTGGCGGGTAATGTACCCGAGGCTACTCGCGACGTCAACACCCATCACCCAAGCCTGTACCGTCGCGA
TGGTCCTTCTCCGATTGTCGACTCGGCGGGTGAAGCGCGCTGGATTGTGGACCGCATCGTTTGCCACGAGGACCCATCTCTGGGTTTCCACCTGACGAGG
ACACGTGGGAGACGCGTGCAGCTCTTCTTCGGGATGTCCCCGATGTTGTTCGTGACTATGAGGCGAAGGTCGCTGCTGCTGAAGAGACCACGGAGCTCCC
CGCGGAAGCTGAAGCCTCAAGTGAGCGTGATGATGGAAGTGGACCCCCACCGCAAGCTCGCGGTGGCGTTCACCGCGAAGACTAAGAAGAAAACCTGACG
ACGACCGCCGGACTCGAACCGGTGACCTCCGCCTTGGTGGCGCAGCGTTCGACCACTGCGCTAGCTGGACTTCCGAGTCCCCACGACGGACCACCCGACC
TGATCAAGCTTGGAGCGACTGCGCATGGCAAGTGGCAAGAAGGATTCGCGTGGGGATCGAACCCACGCGTCACAGCTCAGCACGGCGAGCGCTTGCCCAC
TACACCGCTCCACCGATGATCGCCGGTGTCGAAGATGTCCAAGCTGGTCTCGCTGTTCCGTCCGTTCGAGTCGACGGTTACGCGACTCTTCGTCGGGAGT
TACTTCGAAGGGTCGTAGCGAGGAGCCACGCCACGCTGATCGCCATCCTGTGTCTCGACACTCGCCGGTTCTCCGCTCTGTGCGCATCACAGTTGCGCTT
GTCGTCAAGCGTTGGTGTCGCTTCCCATGCTGCGTCGTTGCCACGACCGCCGTCCCTTCGGGTGTCCGTGGATGTCCGCGGCCACTTGGGGCGCTGCGCA
TTGCTTCGGCGTGTGCGCCGACGAGATGTCTCGGTGTGTGTAAGCTTGCTGCTCTTGCGTCGTCCTGTGTCGCTCGGTGGCACGAGCGCCGTCCCTCCGC
CGCCTCGGTCGTCCATGGTGTTCTTCGAGTGTTCTTTCGGAAATGTGTCTTTTGCGCTTACGTTGCGTAAGCGCAACTTTGAGAGGGGGGGTGATGTAAT
GGGCCCCATTTACATAAGTAGGTAGATTGACAGTACATAAAGTAGTTAAGTCAGTACACGGCTAGCGTGTACTGACGGTCATCGTGATTGGCTGAATTGG
GGGAGCCAGACCCCATTTCAGCCAATCAGGCGTTGACTTGCATTTGAGTGGCTCATATGAGACCAGGGGTAGCCGCCCTGGTCCTTACATAAAACGGAGC
CCAGAGTTTCAGGTGAAAATGCACCGCGACTTTCAGTGTTGAAGGACGAGATGACTGTTTTTCAGCGTAACATCCCGGCTCCCTCTCTGATGGGCCCTGT
CCTGGGTCGAAGCTCGTATATTGACGACATCGCCCATGGTGCGCCTACTTGGGAGCGGATGTGCCAGGATCTGAACGCGCTGCTCTTCCGACTACGTTAC
TGGAATATCTCTGTGAGTCTTCCCAAGAGTGAATTCGGGAAGTTGTCCATTCCGTACCTCTCCCATAAGATTATTGCTGAGGGTATCCGGGCGACCCCTA
AAGTCGCGAAGGGGGTCCAAGACTTGCCGTTCCCGACGACACTGAAAGACGTCCAGAGTTTCATGGGGAGTCTGAATTACTACAACAAGTTCATTGAAGA
TCTACCCATGATCGCGGCCGTCCTGTACGAGCTGACTGAGGAACAGGTGAAATTCAGGAGAGACCTGTCGAGAGCCCAGGAAGCCTTTGAAATCCTGAAG
CGCAAGATTGTTTCGACTCCGTTACTCAGACATCCTGATCGTTCAATGCCCTACGTGATTATTCCCCACGCGAACCCGTGGGCAGCATCCGCTGTGTTGG
GCCAGGAGTACGACGGGATTGTGCATCCGGTTCGATTCACCGGACGCGTCCTGAATGACGCTGAGCTGCGGTATCACATTGCGGAGAAGGAGGTGATCGC
TATCCTGAGAGTCCTGGAGGTGTTTCGCACTCTGGTTGAAGGCAGCCCTAAGATCGTTGTCTACACGCGATACTCTGTGTTGAAGTGGTTGCTGACTTTG
CAGTCGGCAGACGGTCGAACGGTGAAGTGGGGTCTGAAGTTGTCCCACTGGAACCTGGAGATACGCATAGTTCAACGGGATAAAGACGGCTTGGCTGCAA
TTCTGGGTGCGGGTATTACCCCCAGAGAACACTTGGATGATATCGCTGAAAACTTGATCCCAGCCAAGGGGCGCGTCAAACCTCCAGTGCCTATCAGTAT
GGAAATGCTGGAAGCGGATTATGAGGGGTGTATTCTGAGTTTCGATGGCGCCGCTAAGACCTCCACGCGACAAGGGAGCTGCGGCTGCATTCTGTGGCAT
GTCCCCGGTTGGGAAATCCTGGATGCCCAGGGATTCATCCTGGAGAACGTGACTGTGAATGACGCTGAGTATCATGGACTTCTGAAGGGCCTCACTCAGG
CGATCGAGCGTGGAATTCAGGATGTCGTTGGGGTTGGGGACTCCAGGATTGCCATCCAGCAAGCCCAGGGTCTCATCAACTGCAATCAGCCAAATCTCCA
GAGGAAGCTGGCCGAGTATGAAGTGCTGAAGACGAAGTTCAAGTCTGTGCGGCTGGTGCATGTCAAGCGAGAATTCAACCAGGCTGCAGACTACCTGACG
TCTAAGCCCCTCGCGCTTGGTGAATTCTGGAAGGTGGAGGATGCTGAAGAACGAACACATCTGCAGTTGGTGTCCAAGATTCACGAGAAGTTGGTAAAAC
CGAAGGTGTTATTGAACGTTGGAATTCAAGGGAGTGATTCTCAGGGTGTCGAAACTCTGGGTATCCCTGGACCTGAGTGCGCTCCGTTGCCTGCGGCGGC
TAAAGTGTTCGCAGTGATGACTCGGGCACAGACTCAGGAGACCGAAGCCCAAAGCGAACCCATGGGACCTTTGGAATACCAGGCTGAACGCTGGCGACGC
ATCAAAGTGCACCAGGACAAAGCTGATCACCTGCTGCGACTCAATGATTTCCTGAAGGGCGACACGACGAAGCTGTCGCACGCTCAAGCCTGTTGCTTTT
TCAGGATGCGTTCTCAGGATTCGTCATGTGCAAACCCATGAGTTCCACCACAGCCCAAGACGTCGCTGAAATGTACGAAGAGCAGGCCTTCAGGAGATTC
GGCGCGAGCTCGATGCTGAGGCACGACCAAGACCCAAGGTTCATGAGTGAGGTGTTCACGCGCTTCCGTGAACTTCTGGGTAGAAAGCAGCGGGCCACTC
TGGCGTACCGCCCCCAGGCGAACGGACAGCAAGAGCGGTCGGTGCAGACCGTCGTGCGCAGCATTCGAGCGTACATTGCAGAAGCGGACCAGAGTGACTG
GGACGACCATGCTGAGCGCTTGATATTTGCCCTGAATACATCGTTCGATGCCACTCGCCTGGACACTCCGTTTTTTTCTGGCGCACGGCTAGGACGCACA
CGGTACTGTGTCTGCAATGCTGGGACCCAGGCCTTCAAGTATCCAGGAGCGCACCGCGTACGAGTGGCCCAGGAAGCTACAGCGTGACTACAGTTATGCA
CAAGCTTGCGCTGAGAATCTCCAGAAGAAGGCCAAGCGGGCGCGCTCTGCCGAACAAACCAGGAAGTGGTGAGAGCTGTCCGAACGACTGAAGGCAGGAT
TCGCAGTCGGTGATGCTGGGTGGCTGTGTGGCTGTATATACCGAAGGTGCAGCCCGGGCTGAGCCGCAAACTGGCTCACATGTGGCATGGTCCCTTCAGA
ATCCAGGAAATCCATGACAACTTCCGCGTGAAACTCAGGGTCGAGAACACAGGGTATCGCGTGAACCCCTGGGTACACGTGAGCTGTTTGAAACCCAGAG
CACTATTCCCGAAGCGACCCACTGTGGAGATCGACGTGGACGAGGATGATGACTTTGATGCGGCGCTGCTGCCTGAAGACAATTGGGAGCCCGACACTGC
GAACGACGAGTACGAAGTTGAGCGAATCCTGGATTTGCGCTGGACTAAGCGGACCCGGACAGCGAGACGTATTCGCGAGTACCTTGTAAAGTGGAAGGGG
TACGATGAGGCCGAGTGGCTGCCTGTGTCGAAGCTCAACTGTGGCGCCCTGCTCTACGAGTTCAATCAAGGCGCAAGAGCGCGAGCCCGTTTCCAGGCCA
TGCAGGCTGGAGATGATCACCCAGGAGTCTAGCAGTCTGGGGTGGCAATGACCCAGA