Description :
From Genome Similarity Track
Location :
Scaffold_64:75006- 76712
Transcript NameFunction/comments
Physo_138491reverse transcriptase

Sequence
1706 bases(100 bases per row)
ACGACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCATGCACCGGGTAGTTGCGCTCAACTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCAC
GACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGTGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGAT
CGGCGCCTCAGTCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGG
CGTATCATGCCCGCGTAGTCCTTCACGTACTTGCACAAGTACGCGACCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTTGACCACTAAT
TGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACGCCCGAGCACGAGTATCTCGCTCGCCCCGAAGATACACTTCTTCAG
GTTCGCATAGAGCTTGTGTTTGCGCACGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTGTGG
ACGAACACATCGTCGAAGTAGCTCGATGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCT
GCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCATGCATGAGGATCTGATAGAACCCATCGCG
CAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGAGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGC
TTGTTGTATGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGACTTCGATTCCCGCACTTGTCCAGCTT
TGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTCCCCGGCACGAGATCAAT
TTCGTGCTGGATGCCCTTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGCACGTCCGCGTGCTCCCGTAAGATCTCGTAGTAGGGACTCGTCTTC
AACGAGTCCCAGCTCTACGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGATCCAATCAGTTTCGCCTCAATCCGTACTTCAG
CCTCTC