Description :
From Genome Similarity Track
Location :
Scaffold_1958:750- 3271
Sequence
2521 bases(100 bases per row)
CTTAGCCCTCTGCAATCCTTCATCCAACGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAACCTCCATTGCTTGGATC
TCAACCCGTCAATCCCTCTGCAGGATATTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCTGA
GAGGATCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTC
CTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGACGTTCGTGACCTGGAGGTATTGTGATCGACCTGGTCCTTGG
ATTACTGTAGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACCTTAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGA
TCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAGCGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAGCAAAGTGT
CCCATCCGCCAGATCCAACCTCACCCCGGCTGGCACCATGAAATCCATCCCAAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATGTCAAACCAA
TACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCGATCCCGACACAGTCTTGGATCCGACTCCCAT
CCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCC
CCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTTGCAGATCCATGGATCCAACATCCTCAGATC
CACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGGCGCTTCTCCCAGTAACC
ACGTGCCTCTCCTCTTTGTAGATCCAGGGTTGAAGAAACTTTGGATCTGGAAAATTCGTCCACTTGGCGCACACTAGAGACCCTGGCAACTGACACTTCA
TGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGG
CTCGTACCGCATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGG
ATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTTAATCTCACCACACCCGCGACACACGTAGAAGCAATGATCCCCGGGATGGCCTTTCT
TGCCACACTTCTCACAGACCAGATGTTTCCAGCATTTAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAG
ATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGGGAGTTGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAG
ACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGATTAAGTCCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGAGCCG
TGGGCGTCGGAGCCTTTTAGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGTGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTC
GTCTGCGTCTGGAAGGCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGAT
CCCCCATCCTTGATCTTCAACTTAGCCCGTAGACCGGCCACATTTAGTCGATGTAGATACTCCAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGT
ATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACTGCGCAGCAAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATA
CCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATC
CATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGATATAGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTG
CCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCGTCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTC
CATCTCCACGTCCCGTGCTCC