Description :
From Genome Similarity Track
Location :
Scaffold_221:75- 3693
Sequence
3618 bases(100 bases per row)
AACAATGACCAGAAGCGGATGAGGGATAAGACACTATCCTGATCAGCTCGTATCATAACCGGGGTCTGATTCGGCCGCATCTGAACCAACTTTAGACCCT
AGAATCGGCTCTGCCTTGTACCCATGATACTCCGGGGCAGTGTATCACGGTACAAGCTCAGTGTTTCGTCTGGGTAGCGTAATTCGGATAACGGTTGAGC
CCAACAGTCGCTTGATTTTGGCTAAAGGATCGGCTGATATTTAAAGCGACTCATTTTACTTGATATTTGTATTGGAAGTATTTTAGAGACAAAGCGGCTT
CCGAAAGATGAGAGCAGAAAAAATATGTTTTTTTTAGTCCATGACAGGTGTGCACGCTTCCGGTAAGCTCATGTACTGGGCCAGATTATGTCTGCCGCTG
ATACCCGAGAGGCATAGCATTTAGGGTACTGACAGGTAACGCCAAGAGCTTAGGTCAGTCCGGAAAGGAAATAAAATCACACTACGCTTGCAGAAGAAGC
CCCGTGGACTCCGCAAGCCGGTACGCCGTATAGACCGGGTGCCGTGACACTTTCAGCTGATCTACCTAAGCACTCCGTGACCTGTAAAAGCGCTCGCGCG
CTGTCGTCCATCCTTTGGTGGAGGGTAAAGGGAATTGTACATAAAATCATTCGGGCCGGACTCAGCGGAAGCGACCTGTCACGGCTGAGACGAGTCGCGA
GGAGCCACCCTCTGCGCGCGCACGCCATACAAGCGCCAACCTAACTCAGCAATTTGCTGTCGTGTGTGTAAGGAATCCACATCAGATGGTATTTGTGTGT
TCTACTACACACCAAGTATTCAGGTCTTGTATGAGCATTACTGTGAATGAGCGTAACTATAGATTCGATAAGAAATATTAAAAGTGGACTAGATCCCTGA
GGGGTAATTTCAGTACGCTTCTAGACCCGCCGACACCCGGCTACACCCAACTGGGCTTATTCGGACCCAATTGGAGCCGGTTCTACCTGGACGTTTCCCT
GCGCTCGAGTCCCTAGCGCCGCCGCTTGCTCAAGGCTTGGGACTTCGACTTGCAGACGGATGCATTTTGGATCAGTTGGGCACAGCTTGAAACACGAAAT
CATTTAATAAGAACACCGCTAATTTTAAATTGATACTCGTTTATCAATGCATGTGTTCAACTCGAGGAGAAGACGTTTGTCGCCAGAACCACTAAGCACA
AGCTGGAGCACAGCCTCAAGCTGTGCGAGCTTGTAGAGGCCTCCTGTCTAATCGTCTCATGCTAGGCGATAATGTTTTGTCGACAGTCGATGATTTATAA
AAGGCAGGCGTTAAATTGACAAGCATCACGAAAATTAGCATTGATAGTTCAAACAACAATCCGACCTCCAGAGTAAAACACAGGCCATCGTCGTCGAGAG
TGTAGCCCAGACAATTTCTTGCCGTAGTATTTAGCCTCTTCGCTCTGCGCACGTGTCGTTCTGTGCATACGCTCAGCGTATCAGGCCAGGCACTGACAAC
GTCGCTGTGGTGCCATGGGCTAATTCGTAATCCGGCCAGCGCGAGAGCGCGTAGACCACTAGACTAAGCTGCCTCGGCTTGTACCTTACATCAAAGTTGC
ACTCAACAAAGAAGGAGTGCGATCTTGCTATTCACTGAGAGAAGTGAGCCGACTGAGTCGCCGTGCGTAGCGACGCTTGATCTGTAAAGATCACAAAAGG
CGAAGTGCCTAGCAGATATACCCCGGACGTTACTAGAGATCACTACATTGCAAATTACTCTTTGATATGATCTGGATAGTTCGTCTCTGCAGCTTCTAGC
TGGAGAGGACCAAACACGATCACACGTTCTCGCCCTTTGACGTTTGCTTAGAGTAAAGCATAGATGATTGCGAAAATGGACGTCGTAGACACCTTGCCTT
CGCTGATACCTTGAATGTCAATACAGCGTCCGTGATCAGGTACATTTCGGAGCCGCAACTTCTTGGCAAGGCGTCCGTGATCGCACTAATGTTCGCTCCT
GTGTCGAGGAGGATCCTCGTATGCTTGTCGTTTACAGCGCCTTGCACCAGAGCTCTCATTCTGATTCGTCGGTCGATTTTCTTGGCCGACCACCACCCCT
TTCTCTCGCCAGGGTTCGTCTTCATCATCTTGGAGTGACCCTTGGGCTCGTCTCGCGCTTCTATCGAAACCACGCCGAACGAACCCTCGCTGGTGCCCTC
ATCAGCATCAGCACACTCCACTCTCTCTCCAACACCTTTACCGAGGATTCCACGCCTCCCCTTTTCATTTTCCGTCGCGTTCACACTTGTTACGTAATTA
TCAGGCCATTCACGCTGCCCCGTGAAAGCAAAGATACACTCTGCTTTCATTGAAGGCTTGGCTAACTGAGGCAGCCCGATATGGACCAACTCAGTTGTAG
TTGGCGGGCTGCCTAATTTAAATGGCGCTCCTGAGCGACGGCCTTGAGCTCTGGCAGAAGCTCCTCCTTCGTGCCTATGGTACGCACGAATTTGACAAGG
TATTGGAAGTTGCGGAAAAGTTCGCATTTTCCAGTGTCGTGGGGTTGTTTGCAGAACTTGCATCGCTTGTTGCAGTGATGGGAGTAGTAGTTCATGCCAC
CGCACACCGCGCATGGTACGTACTGTGGGTGTCTGTTGTCGCGGTTGGAGTCGCGTCGACCGCGTTGGTCCTGATTGAACCCACGGTCATCATCTCGGCG
ATCTTGATTGAAGCCGTGCTCGCGATTAGGCGTGTTCACACGCGTCTGACGGTTGTATGGGCATGCGTAGGTGCCTTCAGCGGCTGCACGGCGCTCATTT
TCGTTAGCCGCGGCGAGGTATTGGTCATTTGCATCCAATGAAAAGTCACCATCCCTATTTTTGGGCTGAAAGCCGCTTTACTCGTCTTGACCATCGTTGT
AAGTGTTCTGATCTTCATTTGAATACTCGGTGCCCCCTGAACAGCTTCACGGCCCTCCAATTCAGCTAGTAGATCATTCACCGTGACTTCAATGAGAGTC
ACTCTTGGTTTGTTGCGATTGTCATCTTGGCGACGGTCATCTCGTCGATTGTTGCGGGCGTACACATCGTCGCGTCGCGTATCACGACCCTTGAAGTATT
GATACTCATTATCACGCTTAGCCATTCGCTCCTTACCCTTGAGAACATCTTCGATGATCTCTTCGAGCTCGTGAATGTCGGTGACTCGAGTGTTGTAGAG
ACGCTCCGCCAACTTGTCATCATCGCATGTTGCCAGGAACTACTGTAGGTTTTTTCGCGTCGCGACCACTTTTCTCGAAGTGTAGACGGGCGTTCCGAGC
GTATCCATTCAGCCTGTTTATGTAGTCGCACAGATGTTCATTACGCTCCCGCTTTGCAGAGAAGTGACGGGACAGTGCCGTCTGCGTGAACTGCGAGCAA
TAGCAGCGGATGAACGCATCGCTCAGCAGCTTCCACTTACGCTTCGTCTTCTTCGAAGTTGACGGAGCCAATGAATGGCTCCGTCCCGGAGACTTAGCTC
AAATGCAATGCACCATTTGTCTGCATCTGTATGCGTTCCAGATATTTCGTAGACGAACCCACGGAGCCACTCCATACAGTTCTCCCTATTATTGCGAGAG
CCTGAGACCGGCTGTTGC