Description :
From Genome Similarity Track
Location :
Scaffold_2068:75- 3102
Transcript NameFunction/comments
Phypl_g14629reverse transcriptase

Sequence
3027 bases(100 bases per row)
CCAGCTGTCCTGATTTATGTCTGTTCTTCGACCACTCGAAACCCACCAGCTTCCCGATTCACCATCTCCGCGGATCGTGCCCGATCGCGATCGATCGGCT
TGGATCTGCCGGAACCTGTATGCCGATCTGCGAGCTCCGATCGCCTGAACCTGTATGTCGATCTGCAAACCCCGATCGACCAAAAGTGTATGTCGATCTG
TCAGAAGTCGTATGCAGATCCCGATCTGAAGCCGTTCGCGATCTGCCGTCAGTCGATCCGGATCGCGGGCTGATCACGATCGCCCCAGCCCGTCGATCCC
GATCGAGAGCCGATCGCGATCGCTCGCAATCCGTAGATCTTGATCAAGGGTCGGTCGTGATCGTTCGTGATCCGTCGGCTGTTGGCAGGGCTTAGTCCTC
ACTCCCATTGCTTCCGCGCAAGCATTGGGTCTCCTCTCAGGCCCCGTTTCTACTTGCGTCCCCTGATGTCGCCAGATTATAACAGATTACCGCCGGATCA
CCCATCATCCACACCGTTCCTTCGATCTTATTCTtgctcggcctcgatctGATTAGCCTGGTACCGTCTTTCCTTCCAGCCTCCGGCTTGGCTTGAACGT
CCTCCGATCGCGCGACAGACGCCGCCTTTCTCACTGATCGGGTCCTTTCTCGTACGGTCGGAGATTCTTATCTGGTGCTTCTCCACAACCGCCCCCCTGT
CCATAGTCGTTGCCGTACAGCGGCCACACTTCGGACACACAGTTCGGTCTGCCTCGATATGCTTCTCGCCTGATCCTGATAGTTGACTGATACTCTGGCA
CCCTGGGAGTTGATCGATCAATGTCTGCATCTCCACACAACGTGTAATCTATGTAGTCCGCGTCGCCACGAGTTTCAGATTGAACACCTCGAGATAAAAA
TGCCTTTCAGATCACGATTCCACATCATCTACGACTGTCGCGAAGACATCCATCCACTAACGACCTCGATTGGTTGCACCAAGTCCTTACTGTGGGTAGT
CCCGGGTCTGAGCAAGCTCGGAATGGAATCGCTGGTATCACGTAGATGATTTGCACTGACAGTGAATGAGTTCTCACGATCTTTCGCTCCCATAACGTCA
TTACCCACCCGCCGATCGAGGATCATCGGGACCCGATCAGCTAGTACGTAACCAGGATCGGTTATCCGGATCGCCATGTTTTCCGGCCTCGATATCATGT
TGATGACACTTGACATCACAAACAGTAACGAGATTATTCTCGTGCTTCCATCGGTCCACAcatcgaccagctccagaACACACTCGATCTAATATCATTG
GGACCCGTTCGGCTAGTTCGTAGCTGGGATCGGCGATCCCGATCGCCATATACTCTGGCCTCAACATGATGAGGATGACGCTTGAAAGCACAAACACTAA
CGAGATCACAACCGTGCTGTCCTCGTTCCTCAGATGGACCAGCTCCATAACACACTCGATCGCCGTGCGTGATCCCTGTCCGCGGAGAATGATCTCGATC
CGATCGTCGgtcttcgtcctcgatcGGTCGAATCCAAGTCGGAAGGGTGCCCCCAGACATGATATCAGCCCAGAAAGCTACAGCTTTACCGGACCTGGCC
CAACTCGGTAATCAGAACGCTTCCTCCACTTCGATCGTTTCCTTGCCGATCAGGCCACCTTCCACTCGTATCACACTTCGTTATTCGTCATCGATCTTGA
TTCTTCGTGTCTGATCCGGTACTATGACGTCGGAACGACGTGTGATTCACACAGGACGATCACCGATCTGACTGAGTCAGCTCGTCGGTAGGGCATCCAG
TCGGGTCGACCACGGCCGATAGAATCCGATCTTGGTTACCGTTCAGGCACGACGAAATTGCATACGCATGCACAAACTCACACAATATAAACTCCATTCT
TCCGGTTCCTGGCCTCCCCGTGAATCCGTCTCCTAGTTCCTGGTCGGAGTGACCAACTCACCCCGATCGTTCTGATCTCACTCCTCCTCGTGGGACTGCA
TCGCACCAAACCGATTCTGATTAGCGCGATCCCGCAGGAACTATGTAGGAGTGTCCCACAGTTGAGATCTGCTTTGTCAACCCAGCTGGGCTCTGCAAAC
CCCTTCCAGTGCACCAGGAACTCTCGGTAGGTCCTACCATATCGCGTCCTCCGATCCTTCCGCATATCGGTGATCCGTTCCACTTCGTACTCCTCTGCGT
TCAGATCTGAGGCCCAACTGTCCTCTGGCAGTAGGATCTCGTCAAAATCCAGCCGACCTTCCTCCGGTACAGCTAGCTCGACCTGCGGTCGATCTGGGAA
CTCCCGGACCGGCTTCAGTTTAGGGAAGAGTCGGTACTCCGTCCCGGCGATCTCGAGTCGCATGGAATACTCATTGACCTTCTCTGCAACGCGGAAAGGC
CAGTGCCACAGATGTGCCAGCTTACGCGCGTATCCCTCTTTCACCCGATCCAAGTACAGCCAGACTTGTACTCCAGCCTCGATCCGATGTGGATCGACGT
CATCAGTATGCAGACCGGCCTGATCTGCGAtcgccttgcgcagcttATCGTTGACCTGCGCCCTCGCCTGAGTGTAATAGCGCTGGATCTGATATCTCCA
CCTCCTAGGGTCCCGATCTCGCGTCCGCGTACTACCCAGCGGCACGGTCGCTTCCAGCGTCGATCTCGGATCCCATCCATGTACCAAATAGAAAGGCGAA
TCTCCGCGGATCCGATCCTGAGCCGTGTTGATAGCGAACGTCAATCTCTCGGCATACTCGTCCCAATCTCGCTGATCCAGATCCTGTACATACATTTTTA
atgcgcgcgtcgtcgtctgcaccaTTCGCTCGGCCGTTCCGTTCGCTTGTGGCCGATAAGTCATCGTCGCCCGATGTCGTTGACCGAGGATCTTATTAAA
GGCACGGAAGAAGTCGGACATGAACCCTGGCTCCCGATCGTGTCGGATCGCCTCGCTAGCTCCAAACCTCCGGAAGACGCATTCTTCGTAGGATTCGGCG
ATCGTCTGAGCCGTTCGGGACGCGCTC