Description :
From Genome Similarity Track
Location :
Scaffold_1508:75- 2619
Sequence
2544 bases(100 bases per row)
GGTTATGAGCCCAAGGCTCACGCGAGGGGAGCACAGCAACTAGGACGTCATGGTAGAGCAGAAGAAGACGCCCAAGGAGTCACACGAGGAGAAGAGGACG
ATCCCGCCGTTTGACGGCAAGGACTACGAGGTCTGGCACGAGCGAGTCAAGCTCAAGCTGGAGAGGAAGAAGCTGTGGAAGTACTCCATGGAGGACTTGC
TCGAGCCGGACGAGAGCAAGGAGGCAGAGGCGCACGCGACGTGGACGAGCGAGATGGCCCACGCCAACGAGATCATCTACGACGCAATGACGAATCACAT
AATGAAGACTGTGAAGTATGAACCCACCCCGTTTCGTGTCATGGAGCGCCTGAAAAAGAGATTTATGGGCAAGACGTACCTGAAGTACGCTGAGGAGAGG
GCCAAGCTCAGTCGGCTACGGCTCGCTCCCAACGGCAATGTGCCAGATCACCTGAGCGAAATGCGTCGGCTGATGGAGACCATTGCTGGAGTCGGGCGTC
CTGCGGACGAGTATGTAAAGCCAGCACTATTGATTGGATCTCTGCCGCGCGAATATGATCATGTTGTACAGACGTTTCTCGCCAGCCACAAGCCCCAAAA
TGCTGATGATCCTCCTAATTACGAACAACTTGAACTCGCATTGGAGATGGCTTACGACCATCGCCAAGGTCGGAAAGCAGAGGGCGCCAAGGACAATGAT
GATGAAGAAAAGGCGTTCTTTGCTGGTGGAGGAAGAGGTCGAGGACGTGGTCGCGGCCGTGGACGTGGTGGTCGATCTGGAGGACACGGGCGCGGTTCCG
GTAGTGGACGTGGTTCTGGCGGTCGCGGGAGCCAAGGTGGTGGACGTGGAACTGGACGTGGCCAAGCCGGCAGTGGACAAAAGCCAGGTGGTGCTTGTTA
TCACTGCCATGAAGCAGGGCATCATGTGTTTGATTGCCCGTTTCTTGGCAAGCGACCTCCAGTCGAGGATCGCAGCAGCACCCAAGCTCAGAAGCGCGTG
AAAATGAGTGGAGGAAAGAGTGCTAAGGCTGCTGAAACGAGTAGCTACGCTAATGAAAGTGATGACAGCGCGTATGTTATTCTTCAAGTGATGAAAATGA
AAAAGCCGGTCGCAGACAAAGCCCATGATAACTGGTACCTGGACTCTGGTGCATCGAGTCATATTTCGAACCAGCTCACTGATTTCATGGAGTTCACGCC
TCTTAGCGCCCGGATTCGAGTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN