Description :
From Genome Similarity Track
Location :
Scaffold_6559:75- 1106
Sequence
1031 bases(100 bases per row)
GCTTCCTTTTCGATTACTGACCAGTTCGCCTCAGCGCCCTTGAAAAGGCCCGAGAGACAGACCAGCAGCTCGTGCGACTGCTCTACCACAGAGTCCGTAG
AGACCCAGTCCCTCACCTGTGTGAGCACGACCGCCCAGCCAGTGTTGGACGCGTCCGTGAATAAGCATACGTCGGCCGCGGGGTCCGCAAAGAATGTCTT
GGTGGATGTCGATAGAAGACTCAGAACCATCTTGAATGCAGCTTCATCGTCCTTGCTCCACGGCAGGTCCACACCAGCGAGCTGCTGCTTCTTCCGTCCT
CTCGTCTTCATGACACCTTCTAGTTTCTCTTGCAGGGGCCCGACCACACGTGCGTAGTCCACAATCGATTCGCGTAGCCAATTCACAGCACAAAGGAAAC
TCTGGAGAGCAGCAGCAGTGGGCGGCAGCGGCATGTTGCGCAACACCTCCAGCCGGGCCGGATCATGACGCACACCCTCGCCGTCGATCATCTTTCCACA
CCAGATAACCTGCGGAGCAAACAGCTTGCACTTGGAAGCGTTGAGCTTTAATTTACGTTGGCGCAAGATTTGAAAGAAAACCCTCAGCTTGGCAACGAAA
TCAGACGGGCTCGACGCAAACAGCAACACATCGTCAATCCAGACGAGCACCGACTCGTAGAGGTGTTCACCGAACACCTCATGCATCTGGAGCTGGAAGT
GCAGGGCTGAATCAGCCGCTCCTTGAGGTACACGAGTGGGCGTGAAGACCCCATCCTCCGTGAGGAAGCTAAAGAGCTCTTGGCAGTCGGGAGCCAGGGG
CAGCTGCCAAAAACCTTTGAAGAAGTCAAACTGGCCGAAGCCATATGCACCGCGCACAGCTTGCGTTACTGCACGTAGATTGGGCGTAGTCCCAGCGAGC
GGCACGGTGCACTGGTTCACAGGGCGATAGTCCACTGTCATGCGGTAGTCGTCGCCTCCTTGCTTCTTCACAGGGTGCACCGCACAGGCCCAGCGGCTTC
TGTTGTTCCGGTAAACCAACCCGTTCGCTTC