Description :
From Genome Similarity Track
Location :
Scaffold_317:74998- 76075
Sequence
1077 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCTGCACT
TGGTGCGGAGACCGGAGTGAAGGCACTTGAGCGGAAGAAGGAAGATTCGAAAGTGATTGATTTATCGGGGCTTACACTGTCATCACTACCTAGGTCATCC
AATCATTCTACTCATCCAATCATTCTGTACTCGTCCAATCATTCTACTCGTCCAATCATGGGTGGCATAAACAACGTACCATAATCACAGCGGAATCGTA
TTGGACCGGTTCAGGTTGACCGGTTAATGGGTACAACTGGTACACAGTACCAAGACCAGCAACCCTCAATACGCTTCCTCAATGCGAACACGCGTGGATA
CCGAGAGCAGCTGCTAGGTCCATGTGACGAGGCCCTGGGAGCGCCTTCGTCATGATGTCAGCCAGCATCACAGAAGTCTCGCAATACTCGAGCTTGACTT
CACCACGCTTGACTTCATCGCGGATGTGGTGGTACTTGATGTCGATGTGCTTGGCGCGGCCGTGGTTCACAGGATTCTTTGTCATCTTGATGCACGACTG
GTTGTCTTCTTGGATCTTGAGGTCGGGTCCAGTCTCATTGGCAGCTGCTAATATCTCGCACAGTAGGCGATGAATCCACTTGCCTTCTTGAATTGCCAGA
CTTAGCGCGATGTACTCCGCTTCGCTCGTAGACAGCGAAACACTTGACTGCTTCTTGCTGCCCCAACTCACTGGTGCACCCACCAGCATGAACGTGTAGC
CGGAAGTCGACTTGCGGTCCGCGAGGTCACCAGCCCAGTCTGCGTCCGAGTATCCGCGAAAGTCGATGTTGTTACCCGGCTTGTAGTGTTGTCAAGAAGG
CGTCTCGTCCAGCTTCGGCATACCAGTAAAACCGGTTTCCAAGGACCCCGCGATGTTTACGGTAAGTCAATTGCGCAAACGGATGTATGCGCAAACAGAT
GATTGGACGAGCAGGATGATTGGACGAGTCCATGATTGGATGCACCAAATGATTGGATGCAGACTAGGACGTAAGAC