Description :
From Genome Similarity Track
Location :
Scaffold_5:749819- 768810
Transcript NameFunction/comments
Phyci_1654Hypothetical protein
Phyci_89778Hypothetical protein
Phyci_209258M96 mating-specific protein family
Phyci_1657conserved hypothetical protein
Phyci_76720mRNA decapping enzyme putative
Phyci_89783Hypothetical protein
Phyci_492651conserved hypothetical protein

Sequence
18991 bases(100 bases per row)
agttggtgtccgttcagacgttgacatggtaccgatcgtaggaatagcctccaaaatggacagtccccgtttccaatccggcggcggggacatcggctga
attggcacgattagcagaatgggtatcttcgagtaacgtcgacgcttcaacttggttaccatcactctcttcgacttccgagtttgatgattgacccagc
agtataaccgtttccgtgtcactgaactcagatccttcagacagcagcgagttggacatcgattcatcggagacgtatcctgcgttcatggggcttgata
cttgggttcggtgcggtggcggtggtggtattttgaacttggaaggtttctaaatgaccgcttgggcactgtacgaataacaccaatttcagatcaccca
cgttactgcgaaacgacttagcgagcgaccagactactggcaatcgcgatggagcaacgacgaaacagcgaacgaagtaacaattctcagtaaccctacg
atagtggggtagatattaagtcacaacaacacacgaaaatccagcgattcacaattttctaattatcccacaacactctaacatacagttaacggccacg
caaacacacgacatgagaaaccgcaggtcttccacatttttaaatctggtagaataccctcttcatggtgataaaatttgatccaattttgaccataaca
aaaggttgcccccttttgaccaacttctgacccaatgaaaagagttgacccaattttgacctgcgcagcggttgacccataaaaaagTTTATCCGCCAAA
GGTGTAATGTTTAAAAACCTGGCTTGGGTCTTGAAATGAAGCAGTATGCATGCGGAGGAAGGGGGCGATGCTGGGAAACATACGATACTGAATGCGTCGG
AGCAACGCCCCCCTTAGCAACCGCGTATAGCATTCGCTGTAAGGGTGCTGCTATATTACATGTAGTTTATACATGCTCGTGATGGATATCGCATGAAGAG
TGTGTCCTGTCTTCACGTCTAGCTACCTGGTTGCGCGCGCTGGTTCAGAACTTGCTGCACCAGCACGTTCTCGATGAGCTCCTGGTCGGCTTTAATGTTG
CCGGCAGTATTGCCTAGCACGAAGTTGCTGAGCGCGCGCATGTAAGCAGGGTCGTACGTCTGGACCTCGTCGTCGAGCGATgccagtgtacacatctgca
agagcgacaggtcgtggtcctctgtggcggcagcggcacgcttgatcaacgcgtagcaccggtagttaaaggtgagtccagccagcggcttgtgtgcgat
cgaaaccggagagacactcgccacgaggatgacgatctcgcggtcagcttccacgtaccgccgcacgatctgcttcactcgcacatcggcacgagctgta
tttgcgaacagctctttggcgtagtcctcgatgatcgtgtacggagtgtcaagactctGGTAGGTACAGCAGTAGAATGTCAGACCACCTAACCTCCGCA
ACAAAGTTGGTTCCTCTCTAGCCTCACCTTCGCAGCCTTATCATACAATTTGCCATTCCCACCATGCTTCTTCATCCCCTTGAAGTGGTCCCACGTCGCC
TCTGCAGTATCTCGAGCATGGAAAGGCATCGCCTTGTTGGCGAACACTTCTAAGTGCATCCCATTAACGCCCTTGTTCGATCGCAGCTGCACGCCGTGAT
GGCTCGACTCGGTCATGTTCAAACGGTTGGCAGCGAATACTACATCTACCTCACGACGTGCCTTCTCCAGCTCCCCCAAGAGCCCCCTGAAGTCATTGAT
ATCGGCCTTGAAGTCCAACGTCCTCCCAGTGAAACACCTTCCCAACATCGGGCTCGGTAAAGCCGAAAACTCGGCCATCTGCACACGAAAATCGACGAGA
GAATGACTGAGAATCCCCCGACTCATACCTCTCCCCCGCCAAAAAAAATGATGCGCCAAAAACCAACCTGTTGCTTGATCCGCGCCTGCACCAGCGTCTC
CAGAGCCTCCGCCAGCTTCTGCTGCCGCTCTATGATGAGCCTGAGCCGGACGTTCTCCTTCTCGGCCTTGTCCCGCTGCTCCCTCTGTCGACATGCCACC
TCCTTCCACGCACTCGACACCTCGGGGTTGGCCCGACTCACCACCAGCGCGCCCCGCTGTCTGTTCTGCTCGTCTGCGGCCTGTCGCCGCTGTCGCTGCC
GCTGCGGGTGCTGCACCTGCAGCGCCTCGAGCTCCAGCTGCAGCTGCTCCACCTTGCGCTGCAGGAACGTCATCTCGAGCCTTCGCTCCTTGCGCGCGCG
GTTCGGGTCGTCGTACAGCCCCGCCTTGCGCAGCAGCCGCTTCTTGGCGTTGGCGCGCGCTCTGCGCTGCGTCTTGTCGTCCGCGGCGTCGGGCGGCTGC
GGGCCCATGACCTGCCAACTCTCGGCCGTCATCATCGCGCTGGAATCGGGGTAACTGTGCGCCTCGCCGTCCTGGAATGCGTACTCGTCCACGAATGAGA
GCGCCGCCTCAAAGGCGCGCGCCGCGTCCTCGTCCTGCAGAAACGCCATGGCCTGCCGCTTCTCGCCTCTGCTCGGCCGGTGTGCCTTGCTTCCCGTACT
GGAGCTCGGGAGAAGGAGGTAAACGCTTGCACTAATGATTGCAGGGCGCACGCTCTGTCCCACCACGCAGCACTGGTTATCGTCATGACTATGGAGAGGC
ACAATACCAAGCCTCGAAAGGCATAATGTACAGTTATAGATGACAGAGTTTGTGGGTAGCATTGATAACGCATTCTAAGATGTGGtattgtgcttttcag
ggatcagatttgaaaaactaccttttacagcagcggggtaggtaaccgataccaatttagaagcacacgagtgcaagattagaacaaCCAACCAAATCTT
CATGGTAACAGGTCCGGCGAAGGTGTGGAAGCCTGAATGTCGAGAAAATAGCCGCCAATCGGGCCCTTTCTCCTTCGTAGGACTTTTGCAGGTAGTGCGA
AGAATTCAGTTTACGTCGCTTTAGCTAGGACAAAACTGTCCGCATTCATATAATATAGGATATTATCCTATATTATATAAATGCGGATGGTATAATAGAT
GCATATATACATATTATGTAGATATATGCATTAACTCCCAGCAGAAGAGCAACCTCGCCGATCTCCCATGCAATCGGGAGGCATTATGTCTTCCCTGACA
TCCTATAGCTGACCACTGCATTTGCTGGTgtttaggagttaatcagtaggagcatcgattcttacagggatagggtgaaagcaaacccgccaaatccagc
caaattggcggcttcatatctgtagatgagtttgctgctcgtgcttccaggtccgctggacagatctcctctctcccagctattctatgaggctaaacac
ctaccgtattgcccaCTTTCTTCCCCTTCGTAGCGGTCgttttggggatttgaggactgtgacatccatccccgagagccggtttcattttcggtcgctc
tagccttctCCCCTAACTTCTGTCCTTACATTTTATGCGTTACAAATCCTAAGATTAAAGTCCTGTGATGTTTAAAAAGGATAGATCAAAGTCCCAGCAA
AACAACAGAAAAGCACAATACGTGATCTCTATGTTGTGATAGTCCGGGGCCATCAACGTCCTCGTGAAAAAAACTGAAAAGTTGACTCTCCTGTCATCTT
TTTTTCTTGAAACGCTTCTGGCGTTGCAGTTGGAGTCCAACTTGGACCTGGAGCCACGCGTACTGGCTCAGTGCCACACAACTTTCACCCTCATCACCGA
CTTGATGTGGTGCAGGGCAACTGCATTGTGCCGCACAATTTGTGCGAGGTACACTGGACGACGAGAGCTGGTATCCCTCGATCTGATCGGTCTTCCGAGT
CAGTGGTGCAATTTCTGATCCATGAGCACATTCTCGATGAGCTCCTGATCGGCCTTGATGTTGCCCGCCGCATTGCTCAGCAGAAAGTCGGTGAGCACTC
GGATGTATTTGGGGTCGTAGATGGTGCCCTCCTtcgtatcaagagtcacgtgcgcaaccaactgcaaaagcgacagctcttgctcgggcgtagacgattt
cgcacgcttaataacggcatagttgcggtggtgagaagtcagcccagtaaatgccttgcgtttaatctcgattggcgcgatcgtcgccacccaaaccaca
acttcccgatcggcttcgacgtagcggcgaataatctgcttcacgcggacgtccgtgcttgaattgcctgcgaagagctctttagagaaatgttctatga
tcgtgtacggcgtatcgagattctGCAGATCACATGTTCAACGCTAAACAACATTGCTCCAACAACGAAATATGAAGAAAATGGTCGTACCTGCGCAGCC
TTCGCATACAGGTTTCCACGGTGCTTTTCTGAGCCCTTGAAATAGTTCCATGTGGCCTCCGCAGTGGCATGCAGTCCGAAGGGCATTACCTTGTTGGAAA
ATACCTCAAGATACATGCCATTCACGCCTTCGCGCATGTGTAAGTCTTGCTGGGTCATTTCCATCGTGTCAAGGCCATTGCCAGCAAGAACTGCGTCTAC
TTCGCTATATGTGGCATCGAGATACTCCAAAAGTTCTTGGAAGTCTGCAGCATCTGCACGAAAATCTAGTGTGCGACCAGAGGGGCAAGAAATGTCGCCT
GGTCGGCGAATCGACGATGAGCACTCGTCAATCTAGCACGTAAAAAGGTTAGTACCTTAAGAACGCGAACGTGAAAAACGTGGTCGCCACCTACCTGTTG
CTGGGCGCGCTTCAGCAGTAAATTTTCTAAGCTCTTGGCCACTTTGATTTGGCCTTCCAAAACGAGCTTCAGTCGCACATTTTCCCGCTCTGCCTTCTCT
CTTCGGCCCCTCTGACGAGCGGCAAAGCCCTCCCAAATACTTGAAACTTGAACTTCCTTGGAACTCGTAGAGGTGCGTACGTCGCCGTCGCCACCCGCTT
CGCTCCCGTTTTGAGCTGTCGTTATTGCAGAAGTTATCTGGCTCGATCGCTTCTGTAGACTCTGCAACTCCATTTCCAGTTGCCCCACCTTTTCTCGTAA
GTACGCAATCTCGAGCTTCCGTTCGTTGCGAGCGCGGTTGGGGTCTGCGTAGACTCCAGCCTTCCGCAGCATCCTCTTCCTGGCATTGTCTGCTGCGCGG
CGTCTCGCTTTCACGACCTCGACGACCGGACGCGCTGTCATTCCGGAGCTTACCGACCTATTTGACACTGCTGAAGCATGCCGGGACCCTCGATCTGTAG
CATTCGCCACAGAATTCACGGTAACCACAGCACCAGCTGAATTTGCGTCGCTTTCGTGGTTTGGCGCGCCGTTCGACGGTATTTCCAATCCGTTCACGAC
CGGGGGTGGCGCTTCCGTTGGATTGTCGAGTTCTCCGACGCCTGATGCGCTGTCGTCCTCTGCAAAGTCGTCTAGGAAGCTCAGTGCGGCCTCGAACGCG
CGCATGGCGTCTTCATCTTCAGCGAGGAACGCCATCGGCTACCGCCAAAACTGCGTACTATTTCATTTTGGGTAAAAAAAATATTTGGGTAAATTTGTGT
CGAAAACCTTAGGTGGACAGGTTTTATGTCATGGCCGCAGCATCTGGTCCATGAGGACGTTTTCGATGAGCTGCTGGTCGGACTTGATGTTGCGAGCCGC
ATCGTTCAGCAGGAAGTCCGTGAGTGCTCGGACGTACTTGGGGTCGTAGATGGTGCCAGCCTGCGTGTCGAGCATGCCGTGGGAGACGagctgcagcaag
gacaactcgtgctggggcgtcgacgtcctggcacgcttgatgactgcgtaattacggtggcgagacttgaatccaccgaagggcttctgcgccatgtcaa
caggctcaatggatgcgacccacaccacgacttcgcggtcagcttccacatagcgccgcactatttgcttgatgcgaacgtcggtgctggagttaccggc
gaccagctccttggagaagtgctcgataatcgtgtacggcgtgtcgagattctGAATTACAACGCAGAATGGCAGCATGCAACTGTCAGAAACAGCCAAA
ACAGACAAGTATCGTCGGCAGTTCCATCCGTACCTGTGCAGCTTTCGCGTACAGCGTGCCTCGGTGCTTCTTTGAGCCCTTGAAATAGTTCCACGTTGCC
TCTGCAGTGGCATGCAGGCCGAAAGGCATTACCTTGTTCGAAAACACCTCCAGATATAATCCACCCACGCCTTCGCGCATTTCCACATCTTGCTGTGTCG
TCTCCATCCAAGCAAGGCCGTTGCTGGCCAGCACCGAGTCGACTTCGCGGTAAGTGGCATTAAGGTACTCTAGAAGCTCCTGGAAGTCTGATGCATCGGC
GCGGAAGTCCAATGTACGACCAGAAGGGCAAGTTACATCAACCGATCTCTGGATAGACGCGGAGCACTCGGCAATCTGGACGAGCAATCCAATTCAGCAT
AGCAAACGTTGGTCTTCCTCATAACACTAGATTCACAAACGAGGTTGTTGGAGAAGTGGGCGTTGCCTACCTGCTGCTGAGCTCGCTTTAACAGTATGCT
CTCCAAGCCTTTGGCGACTTTGATCTGGCTCGCCAAAATAAGTTTCAGTCGGATATTCTCGCGCTCCGATTCTTCTCGTTGGCTCCGCTCACGAGCAGCA
CAGTCCTCCCATGTACTAGGATCTGACAATTGCTTCTCACTCAAATCTTCATCCGTGGAGATTCTTCTCGCTTGAGAACCATTCAGTTGTTCGTTGCCTC
TAGTACTCGTCGCCAACTCTGTCGGCATCGTCGCTGCGGGGCTTGAGCGCTCCTGCAGAGCATGCAATTTCGTCTCCAGCTGATCCACTTTCTCGTGCAA
ATAGACAACCTCGAGCCTGCGCTCATTGCGTATACGGTTGGGGTTCCCGTAGACGCCAGCTTTGCGCAGCATTTTCTTCTTGGCGTTGGCAACTGCTCGG
CGACTCGAACGCAGCACCTCAGGATCCGATTCTACTGACACAAGGCTGTCACCATTGGATTTTGCTTTGCTCAGCAGTCTAGACGACCGACGCAATGGTG
GGTTGCTCTGCGTTGCAGCAGCAGCAATGGGGTCTGCTTCGGCATCGACTTGAAGCTGAATATCCTCAATTAACGGCAAGTCCAGCTCGTCGCCTTCGAG
TTGCTCGCCCACTGGTGCAACGTCGACTGCAACAGCCTCAATAGAGGAGCCATCGGCACTAAAGTCGTCCACGAAGCTCAGCACCGCCGCGAACGCATCC
TCATCTTCGGCCAGGAAGGCCATCGGCGGCAACTTGTCCTGTCGCCACTGAAAAAAAGTGGCGACTCAAGTTCAAGCCCAATTTATGGTCCGACCAGATC
AGATTAAAAACAATTGTGTCTGACCAAAATCCGATAACCGTGTGCGCCACACCACTGACGCCGTCGCGCCACGTCGTCACAGCAGAACGAAAGAAGCTAA
GATTGCCATGGCTCAACCAGGTACGCGATGTCCTCTCCCCGTGCAGGCAGCGCAGCCCTCGCCTCCCCTCTCACCGCGTGTACGTTGCAGGCTCGTTCCC
GAACCCGAACAACCGTCAGCGGCCGCAGTTCAACTCGACGCCAGGCTTCGGCAACGCGTCGCAGTTCCCGTCGCAGCCCGCCATGGGCCAGCAGCGGGCG
CCTCAGCGCGGGCCTGCGCACCAGTTCTACCAGAAGCCGGCGGCCGCTCCTCAGGTGCAGGCTCCTGCGCAGGACGCAGGGTTCTACGGCGCGCAGGCCG
CGCCCGCCTTCTCCCAGGACGTGAGTGGATAGACAGGTAGTTTGCGCTGGAACAGTTGTGCTGACCTGCTAATTATTGGGCGCTGCGCAGTTCCACCAGC
CAGGGATGGACACCATGCCACCGGCGCAGCAGCAGTTCCAGTCGGCGCCCGCGGGCTTCCAGCACCGCCACCCGACGCATGGGAACAACTTCGGCGGCTA
TGCGCAAAACGTGCCGCAGCAGACTCCGCCGAACAGCAACCCGCGGCCGCACATGCAGCACCCGCAGCAGGCGCAGCAGACAGACTTCATCAACCAGTTC
TCCAGGTGACCAGTGAACTTTTGGGGGAAGGATACAAGTGAAGGAATGCATGGCTGATAAGTATGTTGGTGCCGCTTCCAGCAACCCGATGGCAGGATTG
GCGATGAACAGTGCACAGGATTTCCTGCAGAAGCAGTCGGAGATGTACCTCCCGGGAGCCTATGGCGTGTGGGGAAGTCTGAAGTACTACTTCACTGTCA
ACAACTCCTACGTCAAGAGCCGTCTTAAGGTGAGGAGGACGGGCAGCTTGTTTTAGGGAGGCGCTTATCTGATGAAATGGACTGGTACTGTGATGTCGAT
ATTGTAGATCCTGCTCCTCCCGTTCCGACACAAGAACTGGCGCCGTATGGGGAACGGTGAGCAAGACGAGTCCAAGCCGGTGAGTCTGGTTGTGCATAGA
TCTTGCATTTGGTACTGCTTCTTACGAACTTGCCGACGTGTATACATTCATCAGATGCAATACGCTCCCCCGACTCGCGACTGCAATGCGCCTGATCTGT
ACATTCCGCTCATGGGTTTCCTCACCTACATTTTGATCGTGGGGTACTCCAAGGGCACTTCGAACCAGTACGTTGTGGAGCCATTTGCATCGAATGATAC
AAAATGTATCCTTGCTAACAATATTTTTTCTGCCTCAGGTTTAGCCCAGATGTGATCACCAAGGACGCGAGTTACTGCCTCGTGATGCAATTGGTCGAGA
TCGGTGTGTTGGCCGCCTGCCTCTATGTGCTGAACAGCTCCATATCGTTCCTGGACTTGGTATCCTTCTCCGGCTACAAGTATATCCCGCTGGTGATCAA
CACGGTCGTCTTTCAGCTGCTCGGATCCATCGCATACTACGTGTCGCTCCTGTACACCGGCGTGGCTGTCTCCTATTTCACGGTGAGTTGTGCTGAACTC
TTATCGATTTATCTGTATGTTGCAGCGTTTAACGAATTTTTTCCGACACAGCTCAACTGCATGAAGGGAAGTGTAGCGGAGCCTACTCCTGAAAACCGCC
TCTTCCGGAACTACCTGCTCTTCGGGTACGAAAGATCAAATCCGGCTGAGCCTATATGCTATGTTCGGTCCTCGTTACTAACTGCGCTCTGTCTGCTTGG
AAATTCGCAGCGTGTCTTGCTTACAACTCGTCCTCGTGTGCTGGATTTCCTACACAACCGCGCCCGGCGAGTAGATTTTGCGGCCAAAGGCAGTCGCTGC
AGCTTACACCCTTTCGTCAGCGACACGGGTTGCACACGCAAGCAAGCACGCGGTGGATCTTGACGTCGGTTGCTAGCTGCTTCTCATGTGTAAGAGATTC
TGATAATGACGGAAGCCGCGTTGTCGCTCGAATTGGCGCGCGGCTATCGATAAACTGCTTGTGGCTCATCCAACTCCCTCGGTTGGAGTTTCGATTGTTT
CGTTCGTTCAGCACGACGTGACTTCCTCTCGAAATGGGCGGTGTTAAGAAACACCTAGCTACTAGCCTCCCGTATGCTCTTTCTTCCTCCTCCTTGAGCA
CTGGGGTGACTAACAACTTTACTATGGTACAAAACTAGAAAACAAAATGCAATATCAACTGACGCCCAAACGGTGAGCGGTCCCGAGTGCGATGAGGGGA
GGTGAGCTTATAGGGGGACAGGACACTCGTGCTCCTGCCTTACGGGAGCACGAGGCGCGATAGTAAGCGGTCGCGCAATCCTTGTCAGTCACCTCACCCC
TGCAGTGTCAAGCACACTCTTCCGATCCAAGCGTCGACGCCACTCCCCAGTTACGTCACGACGGCCATGATATCCACGGCGTCAAACTGGAACGACCCGA
ACGGTGACGATCCTGTTGACTGACGAGACGGACTGGGCGACGGACACGTCTCCTCTTCCACGCGCTTCAGCGGCGCTGACGAAGGCCGCGTAAGGATCTG
CACCGGGGCCGGGCCCGTAGGGTTAAATAGTGGAGCTGCTGCTCGCGTAGCAGTTGGTCGTGACGTTGGCTTGCCGAAGTCGTGCGGGTTGCCATCATAC
TCGAACTTCTGCCCCGTGAGGCGCTCGTTCACACTGAACATCTCTTCCACGCTGAAGCCCTTCTTCGCGTTGCCGAACGTCTCGCCATTGAGTCCATCGT
ACGACGTGGCTGTGTCAAACTCCGTGCCGAAGTGGCCGCGATTGGCTTTCTTGGATCCGTTCGAGGTTGGTCTGTCGTTGTGCGGCGTGGAGACTGACCG
CTCCTCCTGCCCGGTCTTCTTCTTGCCACCGCTGGCCTCAACGTTCTGCTGTGCCGCGCCGTTCGTGATCAGCGTCAGCGGCCGATTCCGCGGGGCCGAA
GCCGCGCGGCCTGTGCTGTTGGCAGCAGCGTTGCTGCTCTTCTTCTTGCTGGCCTTGTGGCCCTTGACCCAGCGTTTCAGCCTCGACATGAACGGCATGA
CGCTCCACGTCTTCTTGGGCAGCGCGTCGAACGTGAACCACTTGATGGTACTGATCTCCTTGCGGGTCTGCGGCGCGAAGGCGTAGTCCTCGGGCACGTC
CGGGCACATGTACATGCGCATGCGCTGGTCGTTGGCCACGAACTCGAGGTACTGCTTGGGCGCGAGGTTGTCGCCCACGTCGTAGCCGCACTCCTCGAAC
ACCTCTCGCCGCGCGCAGTCCATGTCCGACTCGCCCTCGTTCACCTTGCCGCGCGGGAAGGTCCAGCTCGTGCCCTTCCAGTTGCGCACCAGCACCAGCT
TGGTGCGCGCCGCGTTGAGCAGGATGCAGCCCACCACGGGCACCTGGCGCTGGTACGTCTTGAAGTCCTGGAACAGCTCGTCGCAGCGGTGCGCGAGCGG
CCGCAGCAGCGGGCAGTGCGCGAACATCTGCCGCGCGAAGTCGTTGAGCTTGACGTGCTGCAGGTGCGCGTACTGGTCGGCGTAGAAGTCCTCGTAGAAC
CAGAAGCACTGCTCGATCTGGAAGAAGAGGCGCTCGCTCGAGGCCAGCTCCGACTCGGGCAGGTTCACCAGGAAGCGGCTCTGCAGCTCGTCCATCACCT
CGGCCAGGCTCGGCTTCTTCTTGGACGTCTTGGACGTCATGGGGCTGCGCTGCTGCTTCGAGTCGCTCGTGGCGCGCGCTGACGGATCCGGCTGCGTATT
GGGGCGTGCCGTGTGCGGTTTCTTTTCTCTTGTGTGGCTTTATTTGGCGGCGGTCTCGCGCCTCGGCTTCAATATGCGGTTGCGAGAATACATGGAGCAT
CCAGAAACGATATGCACTGTTGATCGGATTAGAAAGGTTAACGGTGCGAATACTGTTCGGAACAAGACTTTCGGAAACGCATGTATCGCCGAAATAGATT
GACAGTTTCGAGCGCACAGCAGGGGGGGTATCAACTGTTTTCTGCTATGACGTTGGAGAGTGCGCGGTAGTGatcagggttcggtagtagtgggaaaatc
gggtagtagtcatactactactactatccaaattcaggcaatagtagaatgttatatctatttggtcgtgatgcatcgatggtactaatatgactactaa
tatgactaataatatcactgagttcaagctaccatatctggcgcttactggcctccatacaccatatctcctgccggttgtggtgaagtatgagctgccg
ctgctcacgctcgttgtcgattctcgtcgttagaggagtcatcacgaaaaatcggttgagaaaacgcgtccacgaagcgTGATTCCTATttcctctatgt
gctaactggaatggcaaacacggctgctgcgatccgctatccgcagaccaacactctatgataaagtagaagcgcgaatattattacatactcagagtac
tcatagtatcgtcgattattggcctacggcaacgttctggacgataccctaggtctcgctgacttggaaacgctaCTGGTCTAGTTGCTATCGTtgtgcg
ccatgtattatgtgatggttggtcgttttcatcctcatctcttggtgtgttTGTGTGTTTATCATCttaggtaaacttactgtcttatgcgtgagtaaag
cgaactcggtgagctacatctagcagacctacaatgggcctgcaacatatctaatagccacatcttcacacgttagctaaagttgcttggtcgtacgaga
cttgtttttactagagcctcgtggcttggtaattgctgcaataaccatttccgttaccttgtgggaaacttacttattgagcgtggtagtaataaaatca
tgccaacatgctcaacgccttcagaacgcgggttacttcgcagcccactaacgtgtcctcggttttgcacctctatttcttttagacatagcataacaac
ttcaggctgagctgtgtaactcaactactcacgacctaatctctattacttcctccacctctcctcccccttgccgtcctcctccacctcctacgactta
tcgtccttccatacctcctgcctttaaaatgcaacgactacggcggtgttgtatggtacgactgAGTACTGGTCGTGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCGTGACTTATTTAAAGTCCCTTCCTttca
gacactggttggtaagttgactatgcgcagccgacacgatatagcgccctgcgcacgttttaggccgaggtcgattcttctacactcgagggcgttgact
tcgtaaacaggcagacgtagcaggaagcgtgtattactCCTAGGCTGATGTGTTTGCGTACTCGAGTGTAAATTGCGGACTGAGCTATCCTATCTACCAC
GAACTCTCTCGTTGGGCCTCCACGTGTCTTGTCGAGGCGTCATAGCTGACCGAATTGACGATGCCCATCCGGAGATAGCCTCGTCTTGGTTTCAGTATAC
CCGATGCGACCCCAGCTTCGGAGTCTGTATTCGCACTTTAGCCGGCGAGACGGTTTGAGATAACCGGTTCTACGGACCGGGATCCGGTTACACCGGTGAA
TGTTATCAATGACCGGTATCTATCGGTATCCCCACTGGAATCGGCGGGATGTATCGGCTCCAGGAATAAGATGGGATCTGTGGGAGGTCATAGACCCTTT
GGAGCCGCCACTTCGAAACTTTAAGACTCCATCACAcgactgtgaacattagtgttgtttgactttggtacactgttcacggctgcctaatggtagcgca
gaataagtagaggtctccgacatggcaccctggtgacgaaatcgagggatgaggggtcctaacagcagcggaggtcacgatcatacatatgggtacatta
gtagtgacattattatcactactaTCCACGCTTGTATGGActactattcaattagtactactaatggctccaaccccagtactatagtagtagtagtagt
agtagtagtagtagtagtgatactatctctactaatactactattctggagactactaccgaatcctgGTAGTGATACTTGGCGGGCTTCGGCACCTCGT
TCAGACTGTCGTTTAGACTGTCTGAATGACAGTGTCTAGATCTAGAACGCATGCATCGCCGAAATAGATTGACAGTTTCGAGCGAGGGGGGTATGAGCCT
CGCGAACTGCATTTACCTACCCATCGAAATAACGTGGCGCACACCAAGCAGAACGTTCTGGTCGGATCCCCAATAGTGAGCGCAAGTCAATTTGTTGGGT
TCGCGGAACGTTCGTTTAGACTGTCGAGATCTAGACAGTCTGAGCGTTCCGCGATCGTTTCGGTGGGTAGGGTATTCTGTTGGATAGGTGTTACGCTCTG
GCTTTTTTTCACTGTCTACCTGTGAGATGTGATGCGCTGCGTATCCTTAATACACCCACCATATATTATACCAACCACCTCGACCAAGTGTACCCAAAAT
TTGAGTCCACCCAATCGACCCAAAAAGCACGTCGCCCGAAACAAGGAGGCAATGGAGCGCCACGCCGAGGCGCCGCGCCGCAAGCGCAGCAGGTTCAGCG
ACGCCCCAGCGGCCGCCGCCGCCCCCGACGCCAAGCACGCAGCCGTGGGGTCCGGGTCAACGCCCGCGCTGGACCCTGCGGCCCTTGCGCGCGCTGCAGC
GGCCAAGATATCGCGCGCCATCCCCGGTTCCGCCGCGGCTGCCGCTTTCTCCGCTCCGGTGGCCGCTTCGAGCGCTGTAGTGGCGCATCTGGACCCGGAG
GAGCTTCGCCGCATCGAGCAGGAAAAGAAGCGCCGCACGGATCAGATCTACAAGTCGGTGCAGAGCCAAATGAGCCACATCAAGGCGCTGCTGCGGAAGC
CTAGCgctgctactggcgccgctgctgcggctgcgactgctgcAGTGCAGGCCGCGGGCAATGGCACATTCATGCCGGCACCACTGCTGCTGGACGAGCA
GGGACGGGAGGTAGACGCCGCGGGAAATGTGGTCGCCGAGAGGCCAACGGTGGCGCCTGTGGCGACGCTCAAGGCCAACCAAGCGGGGGCGAGAGGCGGC
GATGCTGCCAAGAAGAACCAAAACCCGTACCTGTCGCATCGGACAGTGGACGAGGACGACAAGCTGGACACGGTGGACCCGAGGCTCAAGGTCACCAAGA
GAGAGACGTACGTGACGAGTTGAAGTGCAGAGGCAAAAAGTACCTTCATGGAGGTGGGGGTTGCTGACATGTGCTTTGTATTGTCTTGGTTTATTGCAGG
CGAGCGCGTAAGACCTTTAACTTTGTCGCTCAAGGCACGTACGTGAAGCAGGCGGAGCAGGTACGCGCTCGCGATGCCAAGAAAATGATGGCTGGGTTCA
CGTCGGGACGCAACCCGAGAGGGTACCAAAAGGAGTCGATCGTGGCTATCGATGAATCGGCCGAGCCGACGCCCGAGGACGACGAGAAGGCAAACAAAAT
GGAGATCGACAGCGTCGAGGTTCCACCTAAGCCGGAGGTGTCTACACCTGACGTAGAGTGGTGGGATGTCGAGTATCTTCCGAAGGACAAGCGAGCTATT
GTGGACAAATTCGGATTTATCAAAGCGAAGGTTCGCAAGGAGAACCCGGAAGCGACTGTAGCTTACTCTGACATGAAGCTCAAGTACTGCGGTACTGCTC
ACGTTATCGAGCATCCGGCTCGGCTCAACCTGATTGTTAAACAAGACGACAAGCCCGTGGCTGTGCCCCTGATGCTCACTGCTGTAGTACGTTATCGCAT
ATTATCCTCGTGTGCCGGTTGCGTGGTAAGTTCAACAGCTAATGCTGATCTACTATTTATCTCGTGAACGATATAGGAGCGCAAGAAGATCCGCCGGCAG
AACCGTGCCGATCGCGAAAAGGAGAAACAGGACAAGATCGCGCTAGGTTTGCTGCCGCCTCCAGAGCCCAAGGTGAAGCTGTCAAACATGATGCGCGTGC
TGTCGGAGCAGGCTGTGGCGGACCCATCGGCTATTGAGCGCAAGGTTCGAGAGCAGATTGCACAGCGCGAGAAGAACCACGAAATGCGAAACCTTGCGCG
CAAGCTCACGCCCGAGGAGCGCCGCGAGAAGAAACTGCGCAAGATCAAGGAGGACGCCGCTGGGGACATTCATGTGGCGCTTTTCAAGTACGTGCTCTGT
GCTATCGTTACATTCCTCTGCTGTGACGTATCGTGTCATGTCCGACTGACTCGGTTCAATTTCTACTACTGAAAAGGGTGCCGGATTTCTCGAACCCGCA
ACATCGTTTCAAGGTGGATGTCAACGCGCAGCAGTACCATCTCACTGGTGGCGTGCTGATCTGCAAGGACAGCAACATCAACATGGTGGTGGTGGAAGGC
GGTAGGAAGGCCATCAAGCAGTACACGAAGCTTATGATGCGGCGCATCGACTGGCAGGGGGCTCGCGAGGCTGAGCAGGAGTCAGACAGCGAGGACGAGG
ACGCTGCCAAGCGCGGCAACGGGTGTCTGCTCGTGTGGCAGGGCGTGGTGGCCCGCAAGGCGTTCAACAACTTTCGTTTCCAAGAGTGCCGGACGACTGT
GACGGCTCGGAAGGTCATGGAGGCCAAGAACGTCGTGCACTACTGGGACCTCGTCGAGAAGTCTGCTGAGACCGCGGCGGCGGCGGCCTCGTGATCGGCG
CGCTGTAGAGAGCCGTAGCCGACTACATGTAGTCGATATCAGATGCAACGAGCCGGCAGAAATCTACAGACGAACGAGTGTACCGTGCAAACGCGCTTGT
ACATTTTCCAGTCATTCTTCTCTTACGATTGCATGCGCGGCCCCGGCCGAGCGAGGCAGAAACACGTCGTTCGCCAGTGCTCGGTCGTCCTGGTTCTGCC
TGTGTGACGCTTAACCCTTTAAGATGGACGCTTGTCATGTCGTGGCGGCGGTGTCGTCCCTTTGTTTTGCTGCTGTCGCGTTGATTCGTGCGCCACGAAG
GTTGCGATCATCGAGGCGAAAGATACCGAACGAGTCGTACGGTACTGTAGCGAGTTGATCCCTTGTGGCATTGCTGCGGCCGTTGAAGATGCAGGCAGGC
AGGCTATCCTGCCATGCGGTGCGGTGCGGCCCGGCAGCTGGAGCTAATCCCCTGTCCGCTCATGCCGAGGATCCGGCGCGGAGCTGGCGTACACGCCACC
TATAGTAGCGATCGGCGGATGTTCCTAGCGCTAGAGGGAATGCGCTCTTTTACGGCGTAGCGTGGCGGATTTTGCGCGTGTGTGCCGTTGCGATGCCTGC
TGAGCTACATGTACGGAGCGCTCTTGACCAGCGCCGCCGGTCGCGATCGTTGCGCTGGTCCTGCTACGCCCGCGTTGCCTCGTCACGCCTATCACGAGCG
TGGCGCCTCCGGGATGCAAACGACGGCGAGAGCGAGCGTCTGGCGGCGTGGCCAGCGCGACTAAGACAGCGTTGGTTGAAGCCGGCGGTCAGAGACCGAG
GAGCGAGTGTCAACTCAGCGACAGCCGCCGCCAGCGATAGCCAGCTCGACGCAAAAATTCCTCGTCATCCGCTCGTCGCGGTCGCGCTTTCGGTGCAGAC
AAGTCTCCGCGTGTAGCGGAAAAATACAGCGGCGGCGGCCTCAACGAGCTGGGCGAGAAGCTGTCGGCACCGACGGCTCTTGCGTTCCAGCCGCGGACGT
CGGAAAGCAACGGCCAAGTAAGCCTCGCGCCAGCTGTTCGGAGGACGCACGTGCCGCGCTGGCAATCGACACTCCACCCGGCCCCCGACAGGCCCCACCC
AGCCTGTTCAGCTCCGTCCTCTCTCTCGGGGATCGCGGCGGCGAGCCCGTCGATCGGATCTTGGTGCACGGATGGTGCTTGACATCTTCTGACTGCAGCc
ggctcggctcggctcggctcggctcggcctggctcggcccgTCCTCGCTCAACGCGACAGGCGTCAAACTCCTTGCCCTTCTCCTTCTTCCGCTGCTGCT
GGCAGCGCCGCAACAGCGACAGCAGCAGGTACAGTATGCTACATACTTTGCATTAGCGGCGGCGCGTTCGTTCACGACGCGGAGAGCTCCGCCGTGTCGA
TCGGTCGAACTGCAACCAGCAAGAAACGGGCCCAGCCGGCAGCAGAGCGCGAGCTCGGGTGCGCCAGATGGAGGATGGCGCTGGGGCGCCGATCATGGCC
GCGGCAGCGTTTGTGCGCCGCTGAGCCCCATCCCTGGCGCCGCGCACCAAGCGCGCCGCGCCGGCGCAACGCGGGGCGAGGCTGTCGCCCGCGTGTGCCT
ATCCCGGGCGCACACTCGCTGCAGTGGCTAGCTAGAACACTGTAGCTGCATGCACCCGCGCTCTATGTCCTCGACGCCGACAGTACTCGCGCGCGGGCCC
CGGGCCTGAGGAAGCTTCGGGTCTCGCCGCGTCCTCACCGCGAACAGCAGCGGAAGAGGGCATACAACCGGAATAAGGTCTCCGCTGCGGCCTGACTCGC
TGTTTGTATGCGGGCCACTAATTCGAGTGGGCCGATAAGGCAGAAGGGCCAGGGTTGTGTTGCGCACTTACGCCGTGTAGTCCGTCGTCGATCCTGATAC
ATTGCCGAGCGGATGGCGCCGGCCGCTTCTACCCGAGGTTCAGCGCCGGTGAGAAATTCTATCACTGTCGCTCGCCGGCCGGCCGGCGAGCAGCGagcag
agcgcagcgccgcacagcacggcacggcacagGCAGGGCAGCGCCAGCACAACGAGCGCCCGGCACGTCACAACGCAATTCGCTCGTATCGGGGACCGAC
AGCTCCGCCTCCCCGTCCTCCGCCCCGCCGCTCGCTCGCCCCGCTCCGCCCGGCAGTGACTGTCGCCTTTGATACGTGCAGTGCGTCGCTCGCTCGTCGT
CTTCCCCCCTCTGCGTCTCCCTCTGGACTCCTCTCGCCTCCGCGGACGCGTGCACCGAGTTACTTACTGTTCAACCCAGCCGGCCCCGCTC