Description :
From Genome Similarity Track
Location :
Scaffold_48:74970- 94775
Transcript NameFunction/comments
Phymu_g2630conserved hypothetical protein
Phymu_g2631myosin-like protein
Phymu_g2632conserved hypothetical protein
Phymu_g2633conserved hypothetical protein
Phymu_g2634hypothetical protein PHYSODRAFT_460860
Phymu_g2635hypothetical protein PHYSODRAFT_534506

Sequence
19805 bases(100 bases per row)
ACGGACGTCCGGTACACTGTGTAAGCCAGGGGCGTGTCCGGGTGGCACGTCTGGGAGCCAATGACAGCCACGCGAAGCTGGCCAGACATGCTGCGACTGT
TGCTGGGCGATGGAGAGCGGCGGGGGGCCCACAAGCTGCGGAAACAACGAGAGAAGAACAGGGTGAACCAGTGGCTAAGTCTGGAGGAAGCAACTTGGGA
GCTCCGTCGCAAATGGCAGAATGAGAGCTGGGATGGTACATCTGTTCGATGCGGAAAAAAATGCCTGGAATGTTTAGGTTGCAGGGATGTTTACCTACTG
TTTTACCGTCGCAAACGTTTATACTGAGATGTGTTAAGGTCAATCCGAATATGGGTTAGCAATATGAATACTTCTACATTTGATGCGGGTAATATCACTA
ATAGCAGTATGTTTAAAGTTTGTAGAGAGTGACTCACAAAAACATACAGGCGTTTGTCGCAACTTGAAAAGCGCGCGGTCGAAAACGTGCGCACGTAGGT
AAAGTTTCAAAGTAGCAACTGGTTCATACTGAACCACTTGACGCGTTGCAGAATGAGAGCAACGTTTTCAGATCATTATTACCGCACAGTTGGAGATCGT
TTAGAGTACGGATATCGCTATGCCGCGTTGACAACAGACATTTTGCTAGCGAATCGCAAGAGTAAAGTCTGCGATGGATATTGACAATAACCGTACAACG
CGGCAACTGGTGCGAGCAAGCCAAAACAAAGATAAAAATGTCAAGTCATCCACTAAAATCGGCAGTTGCCTAATGATGGAAACAGAACTGGTCGATTGTA
CAAGACGGAGGCACGAGAAAGGCCTAACGTTTGCTAACTGTGTTCTGCCTGCTCTCTATGAATGTCACGATCGACTGTCGCTATGGCGGCGAGCTAAAGC
CCATCGAAAGCCTGCGTTGCTAAGCTTTATGGCTGGAGAAAGCGGTTTTCGCCCTCGCCTATCGGACCTTCGGCCGGGAGCTGGATGTGCTGGAGTCCAG
GGTGGGCTCTGACTCAGTTGTTGGCCGCAGCCATGGTGGCAGCGTgtggccagcagcgattCTGAAGCTGCAATAAGTCGCTGGAGCGGGCATAACGGCC
TGATTCAAGGTTGCCACGACAATTCGCTCCCTGTTCTTGCCTACGCACGCCACCCCATACAACGCGGCAAGGTCGTTCCCAGTGGCACGTGAATATACAC
CGTGTATGTATGATACACGTACTTTGGCAATGCCCACGGCTCTCTGACATTGACATTATCGGTAGTGCACGTTGAAGTTCAACGGTTGAACGCAGCGATT
GCAGTGAAAGTCTATCGATAGTGGCGTACTTTGCCCCCACGACTTGTGGCCTACGAGTACTATTCCCCGAAAAAACAATATTTGTACGAGCACTTCCTGT
CATgcaaattgaaaaaaaaaagtatcgTCTCGAACTTGAACCGAAACAAGAAAGAATAGGCCAAAATGGTTTAACAtggttgaagttgcactACTTGTAC
TTTGCTACGGACAATCTCATCGCTGGTTACTTGATGGTTCATAGAAATTCGCTATCACTATCTTCATGGATGGTGCTCTGCGTCATCTTCTCGCTCGCCA
GGAAGCTCAGGTGCTGCAACATGCCAATGTGCTCCTGGTCCGCCTCCCGCCTCGGCTTGGTGTCCAGCACGGCCACCGTGCCGAGAGCGTGTCCGTCGCG
AGAGAAGATGGTCGCGCCGGCGTAGTAGCGGATCTTGACGGCGCCCTTGTCGCCCTTGACCATCGGATTCTCACGGAAGCGCTCGTCGTTCTTGgtatcc
agcaccaccaaaACACTGGGCTGGCAGATCGTATGTGCACAGAACGACAGCTCGCGGGGTAGCGTCGTGTGCGCCATGCCGATATTGGCCACCAGTagct
gctcctcgtcctcgaTAATACTCACGTACGCGATGGGGCACTTCATCGTCTTAGCCGCCACTTCGCAGTACATGTTGAACTTGCCGGACAGACCGAGTTC
TCTGATGTTGAGTTCGCGTAGCACTGTCAGccgctcctcctcgtcgacCGGATAGGGCGGCTCAGGCCACGGATTCAGCcacatgccgctgctgagcGTA
CTGCTGCGATTGCGGTCCGCTGCTGATCCGTTGGACGTCTTTCGACTGGAATTCGACGAGTGAGCACTGCCGCCGCCGGGACGCAGGAAACCTGTGGATC
CGGCCGATGTCGGGCTGTCTAGGGAATGGAACGCCACGCACGACACACAAACACGCATGGACCGGGACTGAATCCGGTGGTACAGCGAGCAGCTGTTGCA
GATGACCTCGCCGCAGGCTCGGCAGTGGTGCTTGCGCTTGaacatgttgaagcgcttgttgCAGATGTGGCAGCTAAAgcggtcgtcgtcgttcacCCAG
GACGTGTGCTGGATCACATCGAGTCTTGGGAGCGCGACGGCGCGCGAGGACCGGGTGTTGCGGAAGGACGACTTGCGCGACGGCAGCCTTGATCTGGATC
CCGGGGTGTGCGCCGTGCTGCCGTTGTGCATCTGCGAGGCGCGAAAGCCGCCCATCGGGGTGATCGAGTCGATGGACTGAGACTTGCGGAGGGAGACGCG
GTGCGACACACGCGGCATCAACTGACTGCTCTGCTCATCGACAGTGTTGAGGTTGTGCTTGGGGAAGTTGCCGTTGTACGTGAACACGTCGTCCGAGGAA
TAGTCCGACGAGACGTCCGAATACCCGGAgccttcaacgtcgttcgagttcgaggTCACCGACCGTGGAGACGATGACTcggaagacgctgtcgaGCTTT
CTGTGTACTGGGTCGCGGCCTGCATCTGCTGATCGCGCTTCAAGTCCGCCAGTTTCCTGGTAGAATCGGCTTCCAGTTTCCTGGTACGATCGGCTTTCAT
CCGCTTTGCTCGCATCCTTCGGCGGAACCTGAAGCGGCACTGCAGCATCCGCACAACGGCGATGAACTGCATAAACTTCTTGCGCTGCACCACGGTCCGG
ATGAAACCCTGCACTTTGCCTGCGTTTTTCCTCCGGATCATCATAATctgacggcgacgacgcagcttctggagcttcttgtAGCGGAATCGGATTTGCA
ACGTCTTGACAGCATGAAGGTAGCGCAGGTAGCGCGCGCGGGCAGTGATACACAGCACAGCGTAGAAGATCTTGATCATGTGGcggtgcagacgctgcgA
GCGCATttcctccaggaactcgtaCGTCGGTTTCTTCATGAACATCTTGGTGAATCCCATCTGAATGCCCACAGTCACGCACTTAGTGGCGAACTGGCCT
TGGTCCGGTCGTTCACAGGCGCCCTGAGGGTTAgcgtcgttctccttcggAATCACATCGAGCAGCCCCTTCAGTAGCTCCTTGGCCTCGCTACTTACGA
CCGCCAGGTTCTCGTCCGATTCTGTATCGGGCAATCCAAAGGAAGTCCCTTGCTTCTTTGCCAGGAGCGGGTTCTTCGGGTTCTTGGATCTGCTCAAGCT
GAAGTAGCGCGCGACAAACTCATCGTGCGGTAACCGGATCGGATACCCTGCTCTTGCCACACGAACCGCCTCCATCACTCCGTTGCAGCGCAGTTGGTTC
AACACACGCTCACGCTCGTAGATCCCAGCCTTACAGAGCTCGTTGGGCTTCAGACAGCGCACGTAATGGGGgttcgtctgctgcagcgtctccaacagcg
tcgtAAGCTGTTCCTTGAACTGAAGACCGACACTTGCGCCGCGGTGTTTACTCGTTTGCGCCCGTTGACGCGGAGATGACTTGGCGCGATCCCGTGAGCC
TCCAATACCTTCACACAAAGTGCGAGTAAAGCTGTCTTCCCTTGTAGAGTACACGAGCATATCCACAGCCTCTTGATGAAGAACatccttgttcttctcc
aggAATCCATCTGACGAGTATTCCACGTGGCCTGCGTAGTGTACAACAGTGAAAAGACCACGTGCGCGCTGAATACGCGAAGCTTCAAAACGAGGGTGAC
TGCCACAGGCGCGGTAGAGCTTCGACGCCAGCGTCGTGTCACTTCCCTTGGGCATGACGCACTCCTCGTCAATGAGGGACAAGATGCCGGTTGGACGCTG
CGAGATCAGGTTCACGCAGTCCTGGTTATCGCAGAACTCGATGTACTTCCAGTCCACGCCCTGAGACTCGTACTCGCGCTGCTCCGCCTTGAACACGTAG
TCgttgaactgctgctgtagtgTTTCGTTGGCGAAGTTGATGCACAGTTGCTCGAACGAATTCTTCGGGAACACTTCAAAGCCGAAAATGTCCAGAATCC
CGATAAAGTGAAGGCCACCCTTGGCCTTCTGGCTGTCGTCCATCTTGAGGAAGTggttgatcttcttcaccatcCAGTCGAACAAGCGGCCGTACAGTGC
CTTCGCGAGCGCGTCACGCGCATTGTTGGCCTGAGCAGCGGAGAGCTTCATACTCACGAAATCCGTTCCCGCACGAATGCGACGCACACTCAGCGCGCGC
TCCAGCTTGGTCGCGTCGACGGCCATCAGTGTAGCGGCGGCGTCGCGGGACCAGATGCAGCTAGGCGCCAAGTCCGACTTGCCGGCTCCCGGCCCCATGG
ATTGGCCCAACCTGTCGCTGTTTTCGTCGTGCTCGAAGGACAAGTTGCCGATGTGCATGAGAGCCGCCAGGATGTCGAAAATACCTGCACGTTCAGCGGG
CGTGAAACCCACGATAtccatggcgtccatgaCCCGTCGGAACATGTCCGAGTCCTTGACGCCGTCTCGACGCTGGTAGCACTCGCTCTGGTTCAAATAC
CGGTAGTGCAGGAACTGGCGCGTTGTCTCCGTGACTTCCGTGTCTCCAGGAGGCATCATGTGGCCGTTTGGGGGGTCCAGGAACCAGCGTTTACGAGCTG
CGGGGGCTGCGCCGATGGCCATTTCGTAGAAAATGTGGTAATTCCGCTCCCCCTTGGACTGCGATACAAGCCGAACCTTCTCGAGCAGATACGTCTGGAT
ACTGGCGCCTGTGAGTCTCCCGCCGCTGGTGAAGTGCAGCTTGATGAACTTGCCGAAGCGACTCGAGTTGTCGTTGCGTAGCGTGCGCGCGTTCCCGAAG
GATTCGAGCAGAATGTTTGTCTGCAGCACTTTGGCTGCGATCCCGTCGGGAGTCTTTCCTGCTACGGACGCCGCTAGATTGTTCACGCCTGCCTGTGCTA
AGTATTCCATGAGGAACTTGGTGCTTTCCGTCTTGCCACTGCCGCTTTCTCCACTCACGAGGATGCTCTGGTCGCTCATGACGCCGTTCAGTCCGAGCAT
CATGGCCTTATACGCTTCTCCAGCCACGTTGTAGATGTGTGGGGGCATGGGTTCGTTCCCTTTACTGCgcatggagctgcttctggactCGAAGGACAAC
AAGTACTTGGCCATTGTGTCTTTGCTGTAGACATTGGCGATCTTCTGGAACGGGTTCACAGCGAGTAGAATCGCCCCCGTGTTCGTGTAGATTTTCTGCT
GGGCGAAACGCGTCTCCAAGGCGGAAAGAATCGTCGTCTCGTCCAGTTCAATGAGCTGCgtgaggtcgtccacgtcgaacTGTTGGCCCTGCGCGGGCGT
GAGCACACGCACGTCGGGCGCGTCCTGGTTCACATCTTCCGGGACGCCTCGTTCGGCCACGCTGCCATCCTCGAAtttgacgacgatgacggcGCCGGAA
GCCTCGATGGGACTCACGTAGCGGTCGATGACCTGGCCGCGTCGCCATTTCTGCGGCGCTAGCTGCACTTCCACCTGTGCGCCCACGTCCATGGTCGGAT
TGGGCACTGCGCCTCGCCTCGGTGGTGCCTCCTGCCGCCTTACTGGATgggaaggtgctggagctttggGCGCCTTCGTGCACTCTGCCGGCCGGGCCGT
TATTGAGTGAGGGAGTCAGTTGGGCGCCCAACTTGGTCGCATCGAGCAATGACGCTGCACACAACCCCACCACGATCAGGTAGGGACGACGCTACCCACA
TACTTTCCACCCTGATAAAGTTGATATTTCTGTGGGAAATGATACAATGCTATATTTGTCACGAAGTATAAAATTCAGGATTTATACCTGTATAACGAGA
GACGGGGGGAAAGTTGGAGAGTGGTGCGGTGTATAATAGAAGCAAAAGGTCGTGGTTCAGTCTATGGCCGACCAGACTGCGTACTGTACCGAAAAACGAA
CTGTCTCCTACGCGTCCTCTGTTGCTGCGGTGCCTCCTGCACTTGGAGTGGCGAATTGGAGAAAACTGCCAGACGgcggccgagaagctgcgaATGTGGC
GGTGGAAATCTTCACAAAAACGCGTTGGATCGCGTGCTGTAGGAGGTATTTGGCACTGTGGCGGAATATTGGAAGCCCTTCCGCCCGTGTGGGCAATTTT
TAGGCACAACACGTTTTCTAAGCAATTATGCTCTTTATCCTCACGGCGACTTTGCTGGTGCATGTACACCTACCTACCTACCTACTGTAAATTTAGTTGC
TGAAACCACCTATCGTAACCAGATCACAACATGGTCGAGTTTCTTTGCCAGCCGCTGCTTGGAGAATATGAGGTGCACGTTGCACCCGTGTCTAACGCAA
CACTAAAGCGCATTTGTATGTTGGAGCCGGTAGGCTCATCGCTGGTCTCGGAGCTTTTGGTGGTCATACTACTCACTGTAACGGCCGAGCGAGCGGCGAC
AAGTGCCTGTCACCTGCGTGCCACAGGCGGCATACAGAACCGTGTCACTGTACTGTAGACGACAGCACCGGCAAAAGTTGCAAAATTTCATGCTCCACCG
CTCCGACACAGCGTTTGGTCGTCTACCAAAATCCAATCCGAATTTTGGTCAACAAACAATAggcaacagcaacgtcgCGACGTGACTCGAGCGTGTATGC
GTGGTTGTGCACCACGGTAGAAAGGTCATTGCCCAGTCGCGTTGTGCTCGGATTTGCCGGTGACTTGGCTACACGAATGAATTTACGAGTGGGTTTGTTT
GTCGAGTCACTGTTTCCACCGAGCACAGGATCCGATCATGGGACCAAAGTTGGCTATGCCTATATAGGATCCCAGTAGAGCCCTACAATGatcgctccag
cttcatcctGGCGTCTTTACATGATCTATAACGAGCAGAGAGATAgagatagatagatagatagatagatagatagagagagagagagagagaggaTCGG
AGGGCTCAACTATTTGCACGGACACTCCTATCCACGAGCCCACAGTATCTCCTCTATCCTATTGATGCTTCAtcgacgctcttcttcatcctcttcccGC
GGTTCAGAAGCTCTTTCTCGCGCGGTACCAGCCGCAGCTCGCGAACTGtcttcaagaaggcgaagagcagcgagcCCAACGCGTCGTGTGTTAGCACCCG
AACGCCACCGTTTCGTCGATGACGCTCAGCGCCGTTTGTTCCGCTATCTAAGCACGAGGTGTTCACGATCACTTGGCCGTCTGCGAGTACTACCTTAGTC
ACCACGAGAACCATCGAGTGGTAGTCTACGTGGAACTCTGCTTTGCTGTAAATCCACATCACAGCAGTCGTTACAAATTATACCATACTCAATCCACGAC
AATACACTTACAcaacttgcagcagcacttggacACTGTGTAACTCCGCAGAAGTCATCGGTGCAGGCTGGAGTAGGACGCTAGATAAATAGAGGGCAAA
CTGCCCAATGGAGTCCACGGGCGGCTCATCTGAATCGGTGCCCCACGCCGTGCTTTTGTTGCGTCGCTCGCGATGGTATTTCTGaatgaggacgaagaga
aaCGTCGGGAACGGTCGATGTGTTTTCGCCTCAAACTCTGCTTCTACTGCGCAGCAAAATGGTCCAACCCAAAGCATCAGACACAAACCAAGTGCACACA
CCAGTGAGTATACCCTGCACACGATCTGAGCGATAACGCTGTGGCGACAAACCTGCATCATTGATATCCGCAAGGGTAGGTGCGGACATCCCTCCCAGAG
CAGCCATATCCCTCTGAACACGGTCGCAAATTTCTTGCATTGCCGTCTTCAACTGTGCAAACGTCACCACATACTGTCGCGCCAGCCACTGGAAATGGAA
AGCCTGTCGCCGTACTTGGTCCTCCGGATCCAACCCTTCCATCCCTACCAAACTGTTCCGACGGCGATTGCAAAGGAACTCGAAATGCGACGGATCGtcc
tccaacttcttcacgCCAGGGAAACGATACCTCATCACCTCCGTCGACAACAAGTGGAAAGTTTCGTCCACGGCTTCGTATCTAGCTTCCAGTCCTTCAG
CAATTACCCTCAGGCGGTTCACATCCAGCGAACTGAATCGAGCTCCTTTGCGCGCACCACACATCATCAGAATCTGCAATTATCAGCACTTCGTTAGATA
CTTTTCCTACTTTGTCAAAGATTACTGGCAATACAATTGCATACATCATTGAGTACATGGAGATAAATCCTCTctgtggcgctgctgaggTTTAACGCTT
CGCTCTCCTCAGGCGTAGGCTTGTGGTAGCGCAGTCCGTCAATGAAGCGTAACATTTGCGTCGGTGGCTTCACATTGTACGCCGTTTCATCAAAGTTCTA
GAGCAagcaagaaaaaaaaaactgtcAATAATTGCAACGTGTAGCACAATGACAATTAGTGTCCAAAATATCGCCAAAGCACCTCGAAAATTGGCTTCTT
GACAACTTTGCGCAATGCCACGTCGGGCAGCACGAAGCGGCCGCTTCCGGTGGTCGTAGCTCCCGCTAGCTGGAAGACCGAGGCTGGTCGAGGCGCTGGG
AAGCTCACGTTGATGTCGTCGGCCCCGAGCGCCTCCGAGAGCGCCGGCGGCTCAGTCGTGTTCGCCGCCATCGTCCCAAGTGAAGTCTTCTTCCGACCAG
TTTGTATCAGGACGAGCGGGCCCTAACCCGCTCCCTCTATCTATAAATAAAATTGATGTGATATGATTGGGCAACGTCTTTTTCATTTTGAGTAATGGCC
AATGAGAGGATAAAGATCCTTCGGCTTCAAGTGTATCAATAAAATCCTAACTGGACCATGGTGAGTAGGACACTGATAGTAGGCGGAGGCTTGACGGGCG
CTGCCTTGGCGCGACTGTTGCAAGAGGCCAAGCTGGCCAGAGGATATGTGTCGGACGTCTTGGTCTGGGACCGCAATAGCATCCTCGGTGGGCGCGTTAT
GGCCAGGTAAAGCGACAATTTAGAGACGTATCAACTCTTTTTGAGCTGACGGAATTGGGTTCTTAAGGTCCTTCCCGAAGCAGCGAaacgtccacgtcga
catGGGGGCGCAGTACTGGACACCCAAGTCAGATCGCAACGACGATTTCCGTCAGAAGTTGACGCAGAGCGGCCAATTGGTGCCATTCGCTGAGAACGAG
ATCGCCGACGACCCGCACAAGGGAGCAGTCAAGACGCACCTAGTTTCTCCAGACGGGAAGGGCTTTCGGGCTGTTGTGGAGCACTTACTGGAGGGTGAGC
TTGCTGAGGAAATGACTGAGGGCTGCCGTGTAGCGAAGGAAGGTGGCTTACATGAACGATTTGATGCTTGACTGTGATCATCAGGCACCGAGACGAAGTT
GTCGACGCACTTGGAGAGTTTTCGAATACTAGACGACAAGCGCATTCAAGTGACAACAAATGGCGGGAAGGAGGAAGTTGTGGAAGAATTGGTGTTGACA
TGCCCCATTCCAAACGTACGATTTTTCGGTTGACATTTCTTTCGCGTAGTCTCAATGAAGTGGTGTTGTGCGTTTCGACCAGGTCCTGTCAATTCTCAAG
AAAAGCGCCTCTTTCCACGTCGCACCGGAAACTATGCGCGCGTTGGAAGGCGTGAAGTACTCACAGCGCTTTGCTGCAGCCTACGTCTTCGACGAAAAGG
CGGTTCCggcagtggaggagctggtaTGGACGGCCAAGTACGTTCCcagcgacgagagcgacgtcattCGCTTCATGTGCTGGGATAACCGCAAAAAGCG
TGCTAGCGACAAGTCTCCACCGGCGCTGATCGTACACACGTCGGTGCCCTTCGGCTCCACGTTCATAGATGGCGCTCGCCACAACGACGAGATCCTGGCT
ATCATCACTAAGGCGCTGCGGGAGGTATTGCCTTCTCTCCCAGCTGAGCACGATGCGCGTCTGCACCGTTGGCGGTACGTCTGCTGCTTTTGCTAGTGCC
CCCAGATGCTTTCGACTCATGACCACGTTACAGTATCTCGCAGGTGACCGTGCCTTACCACGACTTAAGCACTGCGGAGGGAGAGGATCCGTTAGCTGCT
CTCGTTCTCAGTACCAACCCACGCATCATCGTAGCCGGCGACAGTTTCCTCGGATCGGGCTTCGACAATTGCCTTTTGTCTGCTAAAACCGCTGCCATTT
TTTTACAGGGCGGAGTCGGAAGTTCTCTCTAACGGTGGTGCCAAAGTATCAATTGCCACATGTCAAAAGTGAAGCCATGTCACCAAATACTTATCCTAAG
CGATTTTTTTTGTCTCAAACAAGAATTTGCCATTCATGCTGTCACACGAAGAAAAGATTCAGGAGAGAAGCTCACTCATCAGTCATTATCAATCGCAAGG
TGGAGCCATACATCTGTGGAAAGTCTTCATACAACTTGGTGTACGCGTGGTGTACACATTTAACCATAGTGAAACTCCGTGTCCCCAATCCCTGATTTGT
TGGCATTTCCTTAtccaccttctcgttcggTTAGACACTAAGACTGAGTACGAGCTACAGGCGGCTATGGATCTCCCAGAGCTAAAAGGTGggctgcttc
tgctgctgctgcatctccaccCAACCGAGACGCTAACACTGAACTTTGGGCAGGTTATTTACGCAAGAAGTCGCGTCACGACCGATGGCAACGTCGCTAC
TTTGAAGCCACGACGCACTACCTCACATACTACAAGGTAAAACACATCTGTCCACTACTGCAATGCCCATACAATCCTAACCTACGCTTGTATCGACTTT
AGAACCGGGAGAGTGAGAAGTTGCTGGCCTGTATCGATCTGTGGCGCACGCAGACCATCGGCTTTAACCCTGTGGACAGCGACAAGCTCGAGTTCTCCAT
CGCCATTGGAGAGCAGTCGTACTTACTCAAGGCCGACAGTCAGGATGACGCTGATCGGTGGGTCAAGGGACTGCAAGCACGGCAACACCGGCCCGAGGGC
ACGCCCTCCGAGGTCTTCAGTCTCCGCAGCGAGCATATGGACGCCGAGAGCGACGCGTCTAGTGAATATGGCGGTCGACGTCCGCGAAACGCGTCATCAG
ACTCGGGCAGTCGCCGCTCatccttgtccttgtcctACGTCGAGACGCAGAACCCAGTGGTGCccaatgctgctgctatcgccAGGTTGTCGCTGTCTCA
TGCGGACGCCCCGAATCCCGTGGTGCCGAATGCCAATTTGATCGCGCGCTCGTCATTTTCGCATGCAGAAGCCCCCAATCTTGTGGTACCGAGTGCGAAC
GCTACCGGTAGTCCACCAAAGTATCCGATGGTGAATACGAACCAGCAGGTGACGCGGTCAGTGGTAGCACCGTCGACTGCGGCCAAGAcagcggaggagg
agaccGCTGCCAATGCACAGTGCTGTGCACCGTGCGTGATCATGTAAAATGCGACGACAAGAGGCGATAGGAGCTCTCCAATTCTCCTTCTAACGGCGAT
GCAGGCGAGTTAAAGGAGGCTGGTTGCAGCGGCACACTTAACATTTTTCGAGCCGCGTACAGCTAGTTGTTCACGCCTGCCGAGCTGTCCTTTGTAGACC
GTACGAATGCCACAAAGCTGATGCCCCGACGTGTGGGCGAATCTCGGCTGCTTATTAaatactacgtagtataCAAGACTCCCAAGGACCCCTGTTCTGA
TAAAATGATTGCAATTAGTCCGACAATGAAAGAAATCGACATCGAACTGTTCACTTTAACTTCTCGCAATGATCCGAATACGCTATCGAAATTCTTAGTA
CTATTATATATTCGAGAACGAGtgagacgaagatgaagtgaatctgagtacatgtatcccATCTCCAGTtttgattttcttcttgtcgaaagtatttttt
tttctgatTGAATGCTATTTTTACAGTTATATTAATGATATTATATTAATTCTCTTTAAATATAGACTTTATTTACAATAGTATTTTCTCCAATTAAATT
ATTTCTCTTCAATTTTCTAATTGGTCGATATTCATTTTTGACCAAGTGTCAAAAACGTCTAGGTTCAGCCAGATAGCAACAGGGACGACTCCACACCGAC
AGCATGGGAAGCTCCGACGGTACGTCTGGTGCGTCTGTAGTCGCTCTCCTCGCACTATCACTGATCTCCTGCGTATTCTCCTGCCTTCACTGCCTATTCG
CACTCCGTTTTCGACAGAGGACGAGCGCAAAAAGCGCAGCATCAACGAGATGTTCGGCGATgaggactcggacgactcTGGCAACGAACACATCCCTCAC
AGTACGTATCTCTCTGCGTGAAGTGGTTGACTAGCTCAAGCTCTATCCATCCACACCGCCCGGTTCCCTGTATCCGTCTTCCTTACTGTTTTATGGTATT
TTCGACAAGCctcgaccaccaccacagccgaCGCCTCAGGGTATTTTCGACATCTATTCTCGACACTAGTACTTTATGCTAACGTACAACAACTGCCCAT
GTCTGCAGTTTATTCGGCTCGGACTCggagagtgacgacgaggaggagaaaccCGCCAAACGCCCAGCGTCTCCCCCGTCCAAGCGTGTCAAAAAGTCCC
GAGACGAGAAAGGAGACGGCAAACGCCGTTCCGAAGGAGACGAGTACGACTCGGGGGACGAAGCAGTGGCCAacaaggaagacgacgacttcattgacgg
agatgacgacCTGGCGGACGTGCTGGGCGAATACGCCGAAGACCGTCagcagttcgacgacgagcgtCCGCTGGACGAACcggagcagacgcagcagcag
aaggacgacttcttcgaccGAACGCTCAAGTCCCTCAAGACTGGACGCTCCCGCACGAAGCTCAACCTGTCGGcgcaggagatggagcaggtCACGCAGG
AGGTGCTCTACCGCATGGACAAGGCTTATGCCGACGACCTAGCGAGTATTGCGGAGCGTCGGCCggctctggagaagatcaagttCGTGGATAGCGCGCT
GCACATCCTGCGCAAGTTGCAGTTCCAGCCCATGCTGCTTGACTTCGACCTGCTCACGGTACGTATTCGTCTCTATTGGCGTCCGTTGACGAATTAATTG
GGTTTAACTTGTGCTTTTTTGTACGTGGGAGCAGATTGTGAAGAAGTGGATTCAGCCTCTGGATGATGGCTCACTGCCGAACGTCGGCTTGCGTACCAAA
ATGCTGGAGATGGTGAGCAAAATGCCGGTCTTTAAGGAGCACCTGAAGCGCAGTGGGCTCGGAAAGGTGGTGATGGTGTTGATGAAGCACCCCCAGGAGG
TACGGAATGAGCAAAGCGTTAAGAGTTTGCTTGTTTAGGATACTAACGCGTTCTTGGTGGTCTGCAGACACcggagaacaaggagcttTGCCGCAGTTTG
GTGGAGCGCTGGAGTCGTGCAGTGTTCAACAAGACGTTGGacttctcgaagctggctgagctggaagctgagAAGGCGGAGAACGAGATCTACCGCCGTC
GTGAGCGAGCGTACGTTGTTTTTTCCTCTGTGggaagttgctgcttctgctacTTCTGACGTGGCGAATATGTGTGTATTGTACAGCCGCAGAcagaaga
agtccaagatTAAAGCACGCACAACTGAGCGCGGTGGGAACGTCTTCAGCTCTCGCAATGCTGATCCGGACGTGAAGCCCGACATTTCAGAGCGCGCAGA
GCTGCCAGAGCAATTGCACATTGATTTCTTGCTTCGTCCTCAGTCAAAGATCGACATGAACGCCGTTCAaggcaagaaggtggaccCGGATTCGCGTAAG
GCGCGTCTGGCCAAGCGTATGCAGGAGATCGCTAGGCCCGGCAGGAAGTCCAAGCGCGCCACCGGTGTGAGCATCGAGGGCAGATAAGCAGTTCAACCTG
TGCTTGGTCGCTGGCAGGAGTCAAGTCCTGTAACATGTGTGCCTCTTTGATAGCCATCGATTTCTTTTGCATTTTTGCATACACGCTCCTGTTGATCGCC
TGTTGCCCCGTGCATTGTCCTAACTtgttcttgctcttcagtGTGTTGGGACGGTGCTAGCATAACGCCGCGCTGGACTGAAACGACGACATTTACGCGG
AGCTCATGGAAATAGCACAACAGTCGACGAGCCGAGATGGTGAGCAAGCAGATGCGAggcgtccaagctgctggagcggaGGGTAGCGCCAATGGCGGAG
CAGTCCCAGATCAAGACTATTCAGTCAAAAGGCTCGGGAAGGactcgagaaggagaagtaggccagatgaagaggaggaggacgaatTGAACGACCTTCG
AGTTCCTGATCTCCTCGGCAATCAGCAAGGCGAACTTGCGGATTCTGAGCGTGTGTTTCCTGCACCAACAAGTCACGTGGCCGCTCTGAATCGCGAATTG
AAGTCTCTGGAGACTCGCTACTTTCGAACGAGACTTAACTTGGAGAAAGTCATGGAGAAGGTAAGACAGTTGATCGTTTTTAACTTGCGTTTTCGCTAAT
CTGTTGGTGTTACTGCTCCAGAATGACCAACTGCGTCGTGAgatgaagaaagtggcggCGCACAGCACGAAACAGGAGCGGGAGATCTTCAAACTTCGAC
ATTTGGTACTtgtccgcttcttcctttgcTCTGATCGTTAATACTAATGAATTTATTCCCCAGATCGATCGCATCCAGTCGgagcgcaagcagctcgagc
agcaggcgaTCCACAATCGAGACTACGCCAAGAAAATCGAGCATCGGTTCTTCATGGGGACAAAGGGCAAGTCCCTAGCCCAGTGCAACCTGGACCTCAG
TACCCGATTACGTGCGCTGGAAGAAActctcaagaagaagaacggagcTCTGGAAAAGACTGAGCAAGAACGGGATGAAGCCAGAGACAAGCTCTCCATT
GTGCAGCGCGCTTTGGACACTCGCTTGGACTCGTACCAGTTGAATGGCAGTCTACACACGGGTCTTCTGTTCGAGATCGCAAAGCTACAAGATCACGCGG
AAGCTTTGGCTCTGCAGTTGGCTCAAGAACGGAAGCGTGTATCGGTATTGGGAGCGCAGCTGAAAACCTCCCAGAAACGAGAAGAGGGACTGGAAGATGC
TCGAACAGTGCGTGAAGCTTTGCTTGCCACTTTGGAAAAGGAACGAGCGGGACTTGATGAACAGTTGGCACAGCTGTCGGGCGACGTTAAGACCGCTGCG
TGTGAGAAGGCAACGCTACTGCGTTTTATCCACGAACAAGCTGAAGAGAAGTTCCAGCTCGAGGCGCGACTCAAAGACCAACAGGCTCAACGAcaacagg
agaaggagagatCACAGCACACACTGGAATGCTGGGAAGAGGAAAAGCAGCGGCTGAAGGCGAGTCTTCGAAGTTCACAACAGGAGACGGAGAGACAGCG
AGACGAGCACGAGCGAGTTCTGGTTACTTTACGCGAGCTACAGGAAGCCGATTCAGCGCTGAGAGCTCGAGAAGCCGAGACGACTTTGCAGTTGGAACGG
TTGGAAAGCGCTCGAAAGAAGTGGGAGGAAgacttcttggctgctaAGGACGTCTGTCGAGAGCTGCAAGCCACCATCGAGCAGCATGAAGCAACTGGGC
GTCAGTTGCGTTGGGACCTCGACGCGTTGGACGCCACACGCCGTGAACTACTCGGACAactggagacgaagcagacggaggagcACGCTCTTCGTGGGGC
GATGGAGAGTGCTCTAAAGGACCTGGAGGCCTTGtccaagcagcgcaacgaTGCAGCCAAGGCCATGAGTGAAGCAGTGACTATCAGTGCGTCAtcactt
gaagagcagcaagcgtTGGAGCGCCAGGTTGAAGCGCAACGCTCACAGcttgagaagctcaagacggcCAAGAACCTGCTGCAAAACGCCATGCTCGAAC
AACTGGCGGCACTACGCAAGCAACTGCACGTGGAGCGGCGTCAACGGATCGAAGCGGAGGCTCGGATCAAACACGTGACGGCTCCAGCAAGCACGAATCG
ACCGGAGACAGTGGACTGGGAGGTGCCACGCCCGTTGCCGTCCGCTCCTTCGCCCTCGCCAGCTCCCCTTCCCCCGCATTTGTCTACAAGGCGatcggac
tcggactcggacttgCCGTCAGCTttgtcttctccttcttcctcagcttcatcttctgaCGAGGAAATCTGCGAGGCACTTGAAGAATTCAGTCCGGTGA
AGCGGGTGCCTGTGACTCGTAGCTCTCCAGCTCCCTCACCGGTGTTAGAAGATGAAGCAAATGTCTCCTTGTTGGAACTTGCAGGGGGCATCGACAACTA
GGACAACAGTGTCAGTGgcaaaaaaataaataactTTTAGCTTCCGGCTTCCTACATAGAACACAAGATATCGCCATGGAGATAGCCCACGTGCTTGCCT
CCCCACGTCAAAGTCACATCGAAAGGGATCGGCTCCGCCTCGCACAGAACAGGAGCGGCGTGCATCATCAAATCCGATTCCTTGAGGCACAAAACGCCTT
GACCTCCGTGGCCCTTCTCGGCTTCGATGCTGATGGCGATGTGCACACCGCCGTTCACCGCCTTGGTGATGGCTGAGTGCGTCACGCCATTGGCCATCGC
CTCCCTCCACGCCACGGTACGGAAGTTCGTGTACGCCAACTGCgattcctcgtcgtcatcaacTCGAGCACTGGACTGGAATCCGTTCTGAACCAAGTGC
GCAACCTCGTAGACCTTCCGCTGGAGCGCGTAGACGTCCTCAGATGGCAGAGGGaagatggtggagatgctgacgGGTTCCACCGGCACCAGTTCGAgtc
gagaagcagcgaggGCAGAGAGACGGTCGTTCGTCATGGCCAAAGGCTGAGTTCCTCCCGGTCCAACCGTGAAGTCCGAGTACTGATTGGGTGTCGTCGT
TGCCCTTGAGCTTGAAGTACTTCCAGAGCGAAGTCGGCTTTTTCGAAGCACTCGTCCAACTGCTTGGGCTATCGACGACTTCCTCCGACTCACGGAGATC
CGCACACTATGCCGCGAAGACTCACCACTGCTAGTTGTGCTGTTCGAATTGATGGCGCCACggctgctgtggcttcgTTGGCCAGTCGTTCGACTGCTCG
AGTGGTTCGAACCGTGTCCTCTCCACCGATACCCGGTCGTCTGCACTACAGAGCCCCCATCGCGTTCTTCGTACGTCCAGATGTTGGCATCCAGCTTCAC
CAATTTGATCTTGAACTCGTGCACGTCCCGTTTGTCACGTAATGCGTGGTTTCCCTGGCGCAGATCGGCAATGGCAGCTTCATCCATGTTGTACGAGAAG
AACCggtcgatctccagctcgtaGATGCTGCAGACTGGCTTATGCGTAGATGTCACGATGTCCTCACACGACCAGTAGCCCACGTTCTTGAGCCGCTGCT
TCGTGTCACTCAACGAATGAGCCAGAATGCGGTCCTTATACGCCGGGGGAGAATCTCCTACAAGCATTTCCTCGTCGGCCTCGCAGAAAAGATCACGGCA
TGAACGCTCGCCAACCATCGAGAACGTCGCCGCGACACCGATCTTGCGCGGGAAGGAAGGCAGGAATCGAATCGGGGGCTCTTCAAAGCCAGTGAAGATC
TCCTTCGCCTCGATTGAtgcacgcagctcgtcgtacCGAAGCACTTCCAGCCACTTGCGAGCCGTGTTTTCAGTGACCAGGTCGGATTTGGACAAGAGAT
CGCGGATTTTCTTGTGGTTTCCACGAGCAAAAGGCACGAAATGTCCACTCGCCCCCAGTCGATCGCTTGAACGTTGCTtgttggaagaagaagacaggCC
TAGACGAGCTTCTGGGAGATGAGAAGGGAGCTGGTTGTCCAAGAAAGAGACCCAATTGCTGGATTTGGGCGGTTTTTCGCGATTCTCAGCTTCATCCTGG
ATTACAATCACCAAGCTTTCTGGCCCCTGATCATCCAGAACTGGTGTGAGGACGTCTGGTAGCCGCGGTTGGTCGGCAGGTGACCTTAAGAGCGTGAACG
GGAGGTCGTCCTCGCAGGAAGTGAACACTTCTTCATAAATACTGTCGCCActcgacgaggacgagactGCAGCGCTGCTCCGCTGCATCTCCCAGCTGCC
ATCGCTTTCCTCGAAGATCGTATGGTCGTGCTGGAAATCTgcgctcttcttgccggcTACGCCCTTGCCGTTGCGAATGGCCTTGATCTGAGCTTCAATC
GCGTGGTCCGTCGCTCTCTTCAGAGACTCCGCCTTGTACGCTTGATCGATTGAAGCCGCCAGCGTTGACGTGGACATGTCGACGTCGTAGTTCAAATTGC
CCGAGAGGATTGTGTGGTGGTACAGATTCGGGAAATCAACCGCTGCTCGATCCGCATCCATTCCGAACGAGTGGACGAGACTTGAAGCCACTGCGTGCTT
CGCGAACATGTTGTTCTCCACTCGGTACAGTCGCTGCGAAGAGTTACTAAGAGACGTACTGAGATTGCACGACACAAACGCGATGGACGCGTCGAAGTAG
CGGATGGGGATGCCCACGACCTCGTTGAAGGTTTTCCGCTGGGCCCAGATCCGTCCGTCGGCTGCTTGGAATTTTACATTTCCGCTGGCATCGTCGGCGT
TATTTACAAAAACAATTTGACAAACTGACGCCTGCAACAGCACAATAAAACGTTTGTCAGTGAAACCACACGCATCAGACAGGCATCGTCTTGATGGCAC
GTACGTCTTGGACGTGACCTCGCACAGCGGTCCCAGCAATGGACGTAATCGAACGATAGGCGGTGGGGTAGTTCACTTGGAGAAGGTATCCTCGAATCAC
CTGCTCGATGGTCTGCACTTCAACGCAGTGCTGGAGGGAGAACACGTACAAGTCTTTTCCTGCCGGGATCCAGTCGCTGAGGTTCGTAGGACACGCAGTC
CAGTTCATGTCGAACGTGGTGACGAAGATGGTGGCCGTGCCCATGTGATGCCGCTCCTGCTCCCGCAGCCGCACCGACTGGCGCAGCATATCCTCCGACA
gcttgctgttcttcgtggacgagaCTGCGTTGCTCGTCCAGGGCTCTCGGACGTGGCGCACGACCCAGATGTGGAATTTCCCGTAAATAACGGCGTTCAC
GAAGCCCTGAAGTGGCACAATGGTCGCGTGCAGGAAGTCGAGCGTGAAGGACGTCTGGCCTGTGAATGTAGCGTATCCTCGGTCCACCACGGCCGGCAGc
cagcagaagatgaagccggAGATGTAGATCGTGAGGTTGTGCACTACCGCGTAGTACGcgtcgttggcgtcgtcgttctcgtaCGTCTTGAGTCTCCGCT
TCATGTTGATCTTGACCAGCACGAGGAAAACCGTCATGGAGATGCCGCCAGCGATGACCCAGAAGTACAAAACGCCGAACATCCACCAGAGCTCCTCGGT
CGAGTCGTCCTCGACCACCACCCAGCACCAGAGTCCGGCGTCTCCGAACTTGTCGAAAATGAGGCAGATGGACGGGATCCCCACGGTGAAGAGCATCGTG
CTGACGATGTAccacttgatcttcttcatgagcatCTGCTGGTCTTCGCCCATACAAACCCAGCGGTAGAGATTGAGAGCCATGATGAAGTTCCACGCGA
TCGGA