Description :
From Genome Similarity Track
Location :
Scaffold_95:7496- 11722
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_95-fgenesh-gene-0.7Guanylate-binding protein, N-terminal domain containing protein
Pytap_DAOMBR444maker-pag1_scaffold_95-fgenesh-gene-0.0CAAX prenyl protease 1

Sequence
4226 bases(100 bases per row)
GGGCCTGGTCACAGATAATAGCACAGGCAGTACTGGACTCTATACTGATGGcAACGGTAAGCCATACTGCGTGCTTTAGCTGGAGGAAGAGAGaGGTCTC
GTGGGCTGCAAACTGAATGAGACTGGCGATGAGCAGgccAaCATCAGAGTACCGCAGATGGACTGAGAGGGCATCTCGCTCGTGGTGGAGAAGAACACGG
CCCAGCGTCGTGAGCATCAGGCAtAcTTTtCCccATGGTTGAGCCAGTGGCACACAGACGACATCGTGTCTATTATCGGAACTGAACCACACACTcGAAT
GCAGACAGCATTTGCTCAAaCAACAGTAGCTATTGGGCCTTACACATCTCCGTGTCGCTTCGGACAAGACGAGTCTTGCCAGATGCCTGTGAACCGCTCG
AGCTGCGCGGAGAATCGACGGACTTGAAGAGGAACTCTCGACTACTCGTTCGAAGTTGAGCGACAACGCCTGTTCCACTGGTGGCCACTGGGGCATCCAC
CTTCtctCCAGTGGATTGGGCGGCGCTTTTTGGCGACTTTACACTCTCTAGAACTTGAAGTTTTGCCTCAAACTCTTGGATTTCCTGGTTCACGCGGTCG
ATGTCGCTTTGAACTGCGCTCTTCTTCTTTTGGTACGCGAGTTTGAGTACTCCCGTGTCAGTCTTAGCCTGCGACTTGAGCTGGCGCGAGAATTCGGCTT
GCTCTGCCTTGAGCTCGTCAACCCGCTTGGCCTGCTCGCTCTCGATCACGAACACATGCTGAACATGCTTGGTTTtCTTTTGCACGAGCTCCCGCTCAAG
CTCAaCGACTCGGTCCAAGAGCTCTTTGTGTTGTGTCATTAACGAGCGCTCTTCTTGATGGAATGATCGTTCCTTCTCGATCATTTCTTGTGTTGCGCCA
GTCAAcGCCTGATCCAGGCGATCTCTCTCCGCTTGCGCCGCTTTCTCGAGCTCTGCAGTTCGACTTCGCACCCATTCAAGGTCGCTCTCCAtATTTTTGA
CACGGGAGTTGTGCTTCGCATCCATCGTCGACATGTCCCCCAAGAGACGATCGAGTTCCGCCTTTTtCGCATTCAACTCACCATGCAGCACACGACGCAG
CTCGGATAGCTGTtGGgTGGACTGcTCCAaCTGTTCCTCATACAAACGCTTCTGATCTtCAGCGGAGAATGATGCACTTTTATCTTGGGTATTGGCAGCT
TCCATCTCACCATCCAATTGAGACTTTTCCTCCTGCAAATTGCGCATGTGCTGTTGGTACTGACGGAGAACATtGGCTCCGTAGGACTTGATCGAGTCCA
TCACACCAGCCTGAAGAGCTTGAGATAGAGACTCATACACGGCTGGTCCGGCACTCTCTGTCTCGTAGGCATCtACGGCGTCGCGAAGGTCTGACTTGTA
CTGAATCAGCAAGGCGAGAATGCCGTCACTGAACGATTCTCGGGCACGTCCATCCAAGTCAGCGGCGATCTGTGCAAGGGTTGCAGGCAACTTCTGTTGC
AACAGCTGATCGCATAGCTCTTTGGAGATGGACGCGTTCCTCTCTTGGAGCTTTTGAACTTGTTGAGTGCAATGCTGTCGAAGCGCAGTGACACCGTCGC
GATAAGCAGTTTCTCGGACCTTCTCTGGGAGcGTCGCAGCCACGGCCTCGAGAGACGTCATGACGCGTTGGATACCGCGTAAATGCGCTAGTCGGACACG
TCGGGCATCTATTGGagCTATCTCTTCGTGATCGATGGCTTCTATTCCCAGGTTTTCCTGCATCACCTCTTTATgCTCTAGTCGAGCGcGACCcAACGCT
TCTTCTAGCGTGTGTTCTGTGAGTGCGTTGAGAGCCGAGACGATGGCAGGAGGCACGTTGTTGTTGATGGCTCGCACGTACGCGtCcACGACATGTGGAA
ACTCGCGAGCCTGGACTTCTCTTCCCAAAAGaGACTTGGCAGGCgTCGACATGGCTGTTGGCGACAAGAACGTCGTGTAGATCTTGTCGACAGCCTCGAC
GAACTGTGTTCGCAGCACATCGCGACTCGgTAGCTCTGTAGATGGATCGCTGGCTTCCACAGCGCGACTCAAATGGATACATTCGCGGGTCGTGAAGTAC
TGGTGCACATACATCCGCTGGGCGTTGCGTTGCATGACGGCCTCGCTAAaGCCACCTTCgTctGCAaGACATCGCTCCATGTACTGCGTTGGTGTGAGCT
TATCGCCTGTCTCGACGTCGTTGAGCCATTTCACTTTCGCGttctGCTGCACCCAGACCAACTTGGGCGCGTGCAAGTGGAAGTCCTTGGTCACCGCCTC
GTCGTCCTGGTTGGGCTTGATACGCACCATGGACGCAATGTCGCGCAGCCACGACAACcGCTCCAATGCGGCTGCATCAATCTCTCCGTCGTCGTTGTAC
AGCAGCACaGAACTGAtCAGCAGTAGCAGTGCCATCGCATGGCGCCTGTCGCGATGCTCGTCGTCGACGTCCATGTGGCCAACTGATACCACGACGCGTG
CATTGTCAGGACGAGTACCCTCTGACGGTGGTGTCCACATCCACAGCAGCACTTTGtCCTGTTCCTTGGTGGCATCCTCGTTGAAGGCGACCGAGTCGGC
GTGAAGCAGAGTGCGGAGCAGCAGCTTCTTCCCCGAATCTGGATGCCCCGTGACGCCCAGCACGTGGATGGAGGGCGACgaCAATGCCTTCAGGTACGCG
CGCGCCTGCTCTGGTACATGCAGTGATGCGTCTCCGCCTGGTGCACGCACCACAAGCGGCAGCGGCGTCCATTCCATGGAGGCTGCTGACATTCCTCTGC
TTCCGCCTTATCAGAGTGACTCGGCACGAGTTCAGATTGTCACTCGATGTGGGCCACACCAAATTAAGTGTACCCAacccttttAAGAGCCAGATCAAGG
GAGCATCCCACTCGGATAGTGTGGACCACATcATGTTCGtAtcTTCCATATTATTGTGGGCAGATCGcgATTCCATTGCTCACCATCATGAcGTCACCAT
GGTGGGTGGCGCCTTACTACCGAGAGGACGGATGGCAGGCACCGTCCGTAGGCACCGCGTTCCCGTACTTCCTAGCAGCGCTTCTCTTCTCGACGATCGT
gTATGTCTTTGAGACGTACTTGGACTACCGCCAGCACCGgAAGCTCAAGGAGAAGCAGTTCCCCTCCCGTCTGGCCGACGCCATCGCAGCATTGGGAGAC
TACGAGGCCAAGAAGAAGGAGGAGACAAAGACAACAGCGTCCACAGATGAGAAGACCGAAGGCGAGTCGAAAGAGACGACGTCGCTCTTGGCCACGACGC
TGGACAAGTTCGACAAGAGCCGCGCGTACGGACTCGACAAGAGCGCCTTTGGGTTCATCTCGGGTGCGTACTCACAGATCGAAGGCACGACACTGCTGCT
GCTCGGCTACCTGCCGTTTATGTGGACGATTAGTGCGCAGGCGGTCGAGTTTCtCGGTCTTGATGGCCGCAACGAGATCTACCGCACGCTGATGCTCATG
ACGCTTACCACAGTCCGAGACTCGGTCTTCAGTCTGCCGTTTtCGTTGTACTCGACCTTtGTAATCGAGCAAAAGCACGGATTCAACAAGCAAACGCTgc
GACTCTTCTTCGCGGACAAGCTCAAGGGCTTGGGACTGTTTGTTGCCATTGGCTATCCCGTTGTCGCGCTGCTCATCGTGGTTATTCGCTGGGgTGgCGA
GCACTTCTACTTGTATGTTTGGGCCTTTTTGCTCATGTTCTCGCTGGTCATGGTGACTATCTACCCCGTGCTGATcATGCCACTCTTCAACAAGTTCAcT
CCGCtcGAGGAGGGTGAACTGCGCACCCGCATTGAAGCACTTGCATCGTCGTTAAAGTTCCCACTCACCAAGCTCTTTGTTTGCGATGGATCGAAACGCT
CGAGCCACAGCAACGCCTACTTCTTCGGCaTCTTCAAGAGCAAGCGGATCGTTTTGTTCGACACGCTGCTTGAGCAAGCGACCAACGATGAGATTGTGGC
TATCCTTGGCCACGAACTCGGGCACTGGAAGCtcTGGCACACCGCCCAAGGCTTTGTGATCCAGCAGCTGTACACGTTTGCGCTCTTCTACGTCTTCGGC
CGCTGCATGAATGATgCCCAACTCTTCGCCAGCTTTGGTTTTGCCACGTCCGATGCCGAGAAGTTGCCAGTTATTGTTGGCCTCATGCTTTTCTCCTCGA
CGGTTTGGGCGCCTGTAGACCACACC